Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T31902 Target Info
Target Name Mammalian disintegrin-metalloprotease (ADAM10)
Synonyms Mammalian disintegrinmetalloprotease; MADM; Kuzbanian protein homolog; KUZ; Disintegrin and metalloproteinase domaincontaining protein 10; Disintegrin and metalloproteinase domain-containing protein 10; CDw156; CD156c; ADAM 10
Target Type Clinical trial Target
Gene Name ADAM10
Biochemical Class Peptidase
UniProt ID
O14672
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism A small but significant decrease in luciferase activity was observed specifically in pIS0-ADAM10 following expression of miR-122, which was abrogated when the miR-122 site was deleted from ADAM10 3'UTR. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-449a functions as a tumor suppressor miRNA through regulating ADAM10 expression in HCC. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-448 miRNA Info
miRNA Mature AC
MIMAT0001532
Sequence uugcauauguaggaugucccau
miRNA Species Homo sapiens
Regulation Mechanism miR-448 plays as a tumor suppressor miRNA partly through targeting ADAM10 expression. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ERK activator kinase 1 (MEK1) Target Info
MP2K1_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism ADAM10 protein level was downregulated by miR-451 and the miRNA inhibitors had an opposite effect from miR-451, resulting in increased ADAM10 protein expression level. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-655-3p miRNA Info
miRNA Mature AC
MIMAT0003331
Sequence auaauacaugguuaaccucuuu
miRNA Species Homo sapiens
Regulation Mechanism miR-655-3p might functions as a tumor suppressor by directly targeting ADAM10 and indirectly regulating B-catenin pathway in the development of progression of HCC. [7]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Mammalian disintegrin-metalloprotease (ADAM10) Target Info
ADA10_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
References  Top
REF 1 The association of the expression of miR-122-5p and its target ADAM10 with human breast cancer. Mol Biol Rep. 2015 Feb;42(2):497-505.
REF 2 MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. J Biol Chem. 2009 Nov 13;284(46):32015-27.
REF 3 MiR-449a regulates the cell migration and invasion of human non-small cell lung carcinoma by targeting ADAM10. Onco Targets Ther. 2019 May 16;12:3829-3838.
REF 4 miR-449a inhibits proliferation and invasion by regulating ADAM10 in hepatocellular carcinoma. Am J Transl Res. 2016 Jun 15;8(6):2609-19.
REF 5 miR-448 suppressed gastric cancer proliferation and invasion by regulating ADAM10. Tumour Biol. 2016 Aug;37(8):10545-51.
REF 6 Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. Oncogene. 2015 Jun;34(25):3283-95.
REF 7 MicroRNA-655-3p functions as a tumor suppressor by regulating ADAM10 and -catenin pathway in Hepatocellular Carcinoma. J Exp Clin Cancer Res. 2016 Jun 4;35(1):89.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.