Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T31186 Target Info
Target Name Eukaryotic initiation factor 4E (EIF4E)
Synonyms eIF4F 25 kDa subunit; eIF4E; eIF-4F 25 kDa subunit; eIF-4E; Eukaryotic translation initiation factor 4E; EIF4F; EIF4EL1
Target Type Literature-reported Target
Gene Name EIF4E
UniProt ID
P06730
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism EGR1-mediated miR-141 induction leads to the silencing of eIF4E, a switch from cap-dependent to cap-independent translation in the host cells, augmentation of CPE, and increased virus production. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 downregulated c-Myc and the c-Myc target gene Eif4e. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497 can regulate the proliferation and invasion of GC cells by targeting directly the eIF4E gene. [3]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-34c-3p miRNA Info
miRNA Mature AC
MIMAT0004677
Sequence aaucacuaaccacacggccagg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-34c-3p significantly reduced EIF4E mRNA and protein expression, and reduced luciferase activity in EIF4E 3'UTR-luciferase transfected cells. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
miRNA Mature ID hsa-miR-455-3p miRNA Info
miRNA Mature AC
MIMAT0004784
Sequence gcaguccaugggcauauacac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
Histone deacetylase 2 (HDAC2) Target Info
HDAC2_HUMAN
References  Top
REF 1 Enterovirus-induced miR-141 contributes to shutoff of host protein translation by targeting the translation initiation factor eIF4E. Cell Host Microbe. 2011 Jan 20;9(1):58-69.
REF 2 miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 2010 Nov 22;29:151.
REF 3 The putative tumor suppressor microRNA-497 modulates gastric cancer cell proliferation and invasion by repressing eIF4E. Biochem Biophys Res Commun. 2014 Jun 27;449(2):235-40.
REF 4 miR-34c-3p functions as a tumour suppressor by inhibiting eIF4E expression in non-small cell lung cancer. Cell Prolif. 2015 Oct;48(5):582-92.
REF 5 MicroRNA-455-3p functions as a tumor suppressor by targeting eIF4E in prostate cancer. Oncol Rep. 2017 Apr;37(4):2449-2458.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.