The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-17-5p by mature miRNA transfection resulted in the decreased protein level of target NCOA3; The Underexpression by Underexpression by siRNA Transfection resulted in the increased protein level of target NCOA3. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry; qRT-PCR; Western Blot |
[1] |
2 |
Immunohistochemistry; qRT-PCR; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-98-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaaguuguauuguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
2 |
Microarray |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aromatase (CYP19A1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acugcagugaaggcacuuguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-17 directly binded the 3'untranslated region of NCOA3 mRNA and inhibited its expression in breast cancer cells by luciferase reporter assays. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
E-selectin (SELE)
|
Target Info
|
|
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggugcaucuagugcagauag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcuuaucagacugauguuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
E2 induced the expression of miR-21 reduced the levels of NCOA3 protein. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-33a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gugcauuguaguugcauugca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
ATP-binding cassette transporter B11 (ABCB11)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acuguaguaugggcacuuccag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-20b directly binded the 3'untranslated region of NCOA3 mRNA and inhibited its expression in breast cancer cells by luciferase reporter assays. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Nuclear receptor coactivator 3 (NCOA3)
|
Target Info
|
|