Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T24587 Target Info
Target Name O-6-methylguanine-DNA-alkyltransferase (MGMT)
Synonyms Methylated-DNA--protein-cysteine methyltransferase; Human O(6)-alkylguanine-DNA alkyltransferase; 6-O-methylguanine-DNA methyltransferase
Target Type Clinical trial Target
Gene Name MGMT
Biochemical Class Methyltransferase
UniProt ID
P16455
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181d-5p miRNA Info
miRNA Mature AC
MIMAT0002821
Sequence aacauucauuguugucggugggu
miRNA Species Homo sapiens
Regulation Mechanism MGMT Is a Direct Target of miR-181d. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 Microarray; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [4]
2 qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Regulation Mechanism MGMT was a direct target gene of miR-370-3p. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-648 miRNA Info
miRNA Mature AC
MIMAT0003318
Sequence aagugugcagggcacuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-648 represses luciferase activity and functions as regulator of the long UTR-expressing MGMT isoform. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 RT-PCR [7]
Representative Target(s) Regulated by This miRNA Endothelin-1 (EDN1) Target Info
EDN1_HUMAN
O-6-methylguanine-DNA-alkyltransferase (MGMT) Target Info
MGMT_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-409-3p miRNA Info
miRNA Mature AC
MIMAT0001639
Sequence gaauguugcucggugaaccccu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with the pre-miR-409-3p produced a significant down modulation of expression of MGMT protein. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
Fibrinogen (FGG) Target Info
FIBG_HUMAN
miRNA Mature ID hsa-miR-127-3p miRNA Info
miRNA Mature AC
MIMAT0000446
Sequence ucggauccgucugagcuuggcu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with the pre-miR-127-3p produced a significant down modulation of expression of MGMT protein. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-13 (MMP-13) Target Info
MMP13_HUMAN
O-6-methylguanine-DNA-alkyltransferase (MGMT) Target Info
MGMT_HUMAN
miRNA Mature ID hsa-miR-661 miRNA Info
miRNA Mature AC
MIMAT0003324
Sequence ugccugggucucuggccugcgcgu
miRNA Species Homo sapiens
Regulation Mechanism miR-661 represses luciferase activity and functions as regulator of the long UTR-expressing MGMT isoform. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
Metastasis associated gene-1 (MTA1) Target Info
MTA1_HUMAN
miRNA Mature ID hsa-miR-767-3p miRNA Info
miRNA Mature AC
MIMAT0003883
Sequence ucugcucauaccccaugguuucu
miRNA Species Homo sapiens
Regulation Mechanism miR-767 represses luciferase activity and functions as regulator of the long UTR-expressing MGMT isoform. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA O-6-methylguanine-DNA-alkyltransferase (MGMT) Target Info
MGMT_HUMAN
References  Top
REF 1 In human glioblastomas transcript elongation by alternative polyadenylation and miRNA targeting is a potent mechanism of MGMT silencing. Acta Neuropathol. 2013 May;125(5):671-81.
REF 2 miR-181d: a predictive glioblastoma biomarker that downregulates MGMT expression. Neuro Oncol. 2012 Jun;14(6):712-9.
REF 3 miRNA array screening reveals cooperative MGMT-regulation between miR-181d-5p and miR-409-3p in glioblastoma. Oncotarget. 2016 May 10;7(19):28195-206.
REF 4 MiR-221/222 target the DNA methyltransferase MGMT in glioma cells. PLoS One. 2013 Sep 19;8(9):e74466.
REF 5 Upregulation of miR-125b, miR-181d, and miR-221 Predicts Poor Prognosis in MGMT Promoter-Unmethylated Glioblastoma Patients. Am J Clin Pathol. 2018 Mar 29;149(5):412-417.
REF 6 Up-regulation of miR-370-3p restores glioblastoma multiforme sensitivity to temozolomide by influencing MGMT expression. Sci Rep. 2016 Sep 6;6:32972.
REF 7 MiR-21, miR-34a, miR-125b, miR-181d and miR-648 levels inversely correlate with MGMT and TP53 expression in primary glioblastoma patients. Arch Med Sci. 2019 Mar;15(2):504-512.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.