Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22658 Target Info
Target Name Interleukin-8 (IL8)
Synonyms T-cell chemotactic factor; Protein 3-10C; Neutrophil-activating protein 1; NAP-1; Monocyte-derived neutrophil-activating peptide; Monocyte-derived neutrophil chemotactic factor; MONAP; MDNCF; IL8; IL-8; Granulocyte chemotactic protein 1; GCP-1; Emoctakin; Chemokine (C-X-C motif) ligand 8; C-X-C motif chemokine 8
Target Type Successful Target
Gene Name CXCL8
Biochemical Class Cytokine: interleukin
UniProt ID
P10145
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Western Blot; Northern Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ELISA; RT-PCR [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism miR-23a increases NPC cell radiosensitivity through targeting IL-8. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism IL-8 protein expression is posttranscriptionally regulated by interactions of the IL-8 mRNA with the inhibitory miR-93. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miRNA-203 Reduces Nasopharyngeal Carcinoma Radioresistance by Targeting IL8/AKT Signaling. [11]
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 ELISA [12]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-302c-3p miRNA Info
miRNA Mature AC
MIMAT0000717
Sequence uaagugcuuccauguuucagugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-302d-3p miRNA Info
miRNA Mature AC
MIMAT0000718
Sequence uaagugcuuccauguuugagugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Erbb4 tyrosine kinase receptor (Erbb-4) Target Info
ERBB4_HUMAN
miRNA Mature ID hsa-miR-100-3p miRNA Info
miRNA Mature AC
MIMAT0004512
Sequence caagcuuguaucuauagguaug
miRNA Species Homo sapiens
Regulation Mechanism Over-production of IL-8 in the P-SIgA stimulated mesangial cells is regulated by miR-100-3p. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Interleukin-8 (IL8) Target Info
IL8_HUMAN
References  Top
REF 1 miR-106a Is Downregulated in Peripheral Blood Mononuclear Cells of Chronic Hepatitis B and Associated with Enhanced Levels of Interleukin-8. Mediators Inflamm. 2015;2015:629862.
REF 2 The Effects and Molecular Mechanisms of MiR-106a in Multidrug Resistance Reversal in Human Glioma U87/DDP and U251/G Cell Lines. PLoS One. 2015 May 7;10(5):e0125473.
REF 3 MicroRNA-146a: A Dominant, Negative Regulator of the Innate Immune Response. Front Immunol. 2014 Nov 21;5:578.
REF 4 Expression of microRNA-146 suppresses NF-kappaB activity with reduction of metastatic potential in breast cancer cells. Oncogene. 2008 Sep 18;27(42):5643-7.
REF 5 Overexpression of microRNA-155 suppresses chemokine expression induced by Interleukin-13 in BEAS-2B human bronchial epithelial cells. Allergol Int. 2016 Sep;65 Suppl:S17-23.
REF 6 MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 7 Integrated analysis of differential miRNA and mRNA expression profiles in human radioresistant and radiosensitive nasopharyngeal carcinoma cells. PLoS One. 2014 Jan 31;9(1):e87767.
REF 8 MiR-23a sensitizes nasopharyngeal carcinoma to irradiation by targeting IL-8/Stat3 pathway. Oncotarget. 2015 Sep 29;6(29):28341-56.
REF 9 Expression of microRNA-93 and Interleukin-8 during Pseudomonas aeruginosa-mediated induction of proinflammatory responses. Am J Respir Cell Mol Biol. 2014 Jun;50(6):1144-55.
REF 10 Regulation of IL-8 gene expression in gliomas by microRNA miR-93. BMC Cancer. 2015 Oct 8;15:661.
REF 11 MiRNA-203 Reduces Nasopharyngeal Carcinoma Radioresistance by Targeting IL8/AKT Signaling. Mol Cancer Ther. 2015 Nov;14(11):2653-64.
REF 12 Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007.
REF 13 Loss of RACK1 Promotes Metastasis of Gastric Cancer by Inducing a miR-302c/IL8 Signaling Loop. Cancer Res. 2015 Sep 15;75(18):3832-41.
REF 14 MiR-100-3p and miR-877-3p regulate overproduction of IL-8 and IL-1 in mesangial cells activated by secretory IgA from IgA nephropathy patients. Exp Cell Res. 2016 Oct 1;347(2):312-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.