Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T20178 Target Info
Target Name Tumor necrosis factor (TNF)
Synonyms Tumour necrosis factor alpha; Tumour necrosis factor; Tumor necrosis factor ligand superfamily member 2; TNFalpha; TNFSF2; TNFA; TNF-alpha; TNF-a; TNF alpha; Cachectin
Target Type Successful Target
Gene Name TNF
Biochemical Class Cytokine: tumor necrosis factor
UniProt ID
P01375
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 ChIP; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-19a regulates TNFby directly binding to its 3'UTR. [6]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 Luciferase Reporter Assay [5]
3 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism TNFa mRNA transcript is a direct target of miR- 203. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-187-3p miRNA Info
miRNA Mature AC
MIMAT0000262
Sequence ucgugucuuguguugcagccgg
miRNA Species Homo sapiens
Regulation Mechanism TNF-alpha Is a Direct Target of miR-187. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA B7 homolog 3 (CD276) Target Info
CD276_HUMAN
S100 calcium-binding protein A4 (S100A4) Target Info
S10A4_HUMAN
References  Top
REF 1 NF-B-DICER-miRs Axis Regulates TNF- Expression in Responses to Endotoxin Stress. Int J Biol Sci. 2015 Sep 9;11(11):1257-68.
REF 2 NF-B-modulated miR-130a targets TNF- in cervical cancer cells. J Transl Med. 2014 Jun 1;12:155.
REF 3 Decreased expression of microRNA-130a correlates with TNF- in the development of osteoarthritis. Int J Clin Exp Pathol. 2015 Mar 1;8(3):2555-64.
REF 4 Role of miR-19a targeting TNF- in mediating ulcerative colitis. Scand J Gastroenterol. 2013 Jul;48(7):815-24.
REF 5 Microenvironmental interleukin-6 suppresses toll-like receptor signaling in human leukemia cells through miR-17/19A. Blood. 2015 Aug 6;126(6):766-78.
REF 6 TNF- is a novel target of miR-19a. Int J Oncol. 2011 Apr;38(4):1013-22.
REF 7 De-targeting by miR-143 decreases unwanted transgene expression in non-tumorigenic cells. Gene Ther. 2013 Nov;20(11):1104-9.
REF 8 miR-143 suppresses the osteogenic differentiation of dental pulp stem cells by inactivation of NF-B signaling pathway via targeting TNF-alpha. Arch Oral Biol. 2018 Mar;87:172-179.
REF 9 Regulation of pro-inflammatory cytokines TNF and IL24 by microRNA-203 in primary keratinocytes. Cytokine. 2012 Dec;60(3):741-8.
REF 10 IL-10-induced microRNA-187 negatively regulates TNF-, IL-6, and IL-12p40 production in TLR4-stimulated monocytes. Proc Natl Acad Sci U S A. 2012 Nov 6;109(45):E3101-10.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.