miRNA General Information
miRNA Mature ID	hsa-miR-187-3p
miRNA Stemloop AC	MI0000274
miRNA Stemloop ID	hsa-mir-187
Sequence	ucgugucuuguguugcagccgg
TTD Target(s) Regulated by This miRNA	Tumor necrosis factor (TNF)	Successful Target	Target Info	[1]
	B7 homolog 3 (CD276)	Clinical trial Target	Target Info	[2]
	S100 calcium-binding protein A4 (S100A4)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	B-cell lymphoma 6 protein	Regulated Protein	BCL6_HUMAN	[4]
	Dihydropyrimidinase-related protein 1	Regulated Protein	DPYL1_HUMAN	[5]
	Hepatocyte nuclear factor 3-beta	Regulated Protein	FOXA2_HUMAN	[6]
	Homeodomain-interacting protein kinase 3	Regulated Protein	HIPK3_HUMAN	[7]
References
REF 1	IL-10-induced microRNA-187 negatively regulates TNF-, IL-6, and IL-12p40 production in TLR4-stimulated monocytes. Proc Natl Acad Sci U S A. 2012 Nov 6;109(45):E3101-10.
REF 2	MicroRNA-187, down-regulated in clear cell renal cell carcinoma and associated with lower survival, inhibits cell growth and migration though targeting B7-H3. Biochem Biophys Res Commun. 2013 Aug 23;438(2):439-44.
REF 3	miR-187-3p inhibits the metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by targeting S100A4. Cancer Lett. 2016 Oct 28;381(2):380-90.
REF 4	MicroRNA-187-3p mitigates non-small cell lung cancer (NSCLC) development through down-regulation of BCL6.Biochem Biophys Res Commun. 2016 Feb 26;471(1):82-8.
REF 5	MicroRNA-187 regulates gastric cancer progression by targeting the tumor suppressor CRMP1.Biochem Biophys Res Commun. 2017 Jan 22;482(4):597-603.
REF 6	MicroRNA-187 promotes growth and metastasis of gastric cancer by inhibiting FOXA2.Oncol Rep. 2017 Mar;37(3):1747-1755.
REF 7	Increased expression of miR-187 in human islets from individuals with type 2 diabetes is associated with reduced glucose-stimulated insulin secretion.Diabetologia. 2014 Jan;57(1):122-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.