Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06800 Target Info
Target Name Suppressor of cytokine signaling 1 (SOCS1)
Synonyms Tec-interacting protein 3; TIP3; TIP-3; STAT-induced STAT inhibitor 1; STAT induced STAT inhibitor 1; SSI1; SSI-1; SOCS-1; JAK-binding protein; JAB
Target Type Literature-reported Target
Gene Name SOCS1
UniProt ID
O15524
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-155-5p resulted in the decreased protein level of target SOCS1. [8]
Evidence Score (E-score) 11 +
1 ELISA; Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [1]
2 ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 ELISA; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 qRT-PCR; Luciferase Reporter Assay; Western Blot [9]
10 qRT-PCR; Western Blot [10]
11 Western Blot [11]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-19a mimics inhibited the expression of a reporter vector containing SOCS-1 3'UTR, while mutation of the predicted miRNA-binding site abrogated this effect. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [13]
2 PAR-CLIP [14]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-let-7i-5p miRNA Info
miRNA Mature AC
MIMAT0000415
Sequence ugagguaguaguuugugcuguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7i targets to the 3' -UTR region of SOCS1 mRNA. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
Bone morphogenetic protein 4 (BMP4) Target Info
BMP4_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism miR-122 targets the nt359-nt375 region of SOCS1 mRNA. [16]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism Increased miR-142-5p induced by IL4/IL13 target SOCS1 and regulated the profibrogenesis of macrophages in chronic inflammation. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 directly targeted SOCS1. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity of the reporter that contained SOCS1 3'UTR was suppressed by miR-221 mimic, but the luciferase activity of the reporter that contained SOCS1mutant 30-UTR remained no significant difference,which indicated that SOCS1 is a target of miR-221. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Regulation Mechanism SOCS1 is a direct target of posttranscriptional regulation mediated by miR-30b. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
References  Top
REF 1 1,25-Dihydroxyvitamin D promotes negative feedback regulation of TLR signaling via targeting microRNA-155-SOCS1 in macrophages. J Immunol. 2013 Apr 1;190(7):3687-95.
REF 2 miR-221 and miR-155 regulate human dendritic cell development, apoptosis, and IL-12 production through targeting of p27kip1, KPC1, and SOCS-1. Blood. 2011 Apr 21;117(16):4293-303.
REF 3 Effect of microRNA-155 on the interferon-gamma signaling pathway in biliary atresia. Chin J Physiol. 2016 Dec 31;59(6):315-322.
REF 4 Interferon--induced miR-155 inhibits osteoclast differentiation by targeting SOCS1 and MITF. FEBS Lett. 2012 Sep 21;586(19):3255-62.
REF 5 MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 6 Rheumatoid arthritis-associated microRNA-155 targets SOCS1 and upregulates TNF- and IL-1 in PBMCs. Int J Mol Sci. 2013 Dec 9;14(12):23910-21.
REF 7 Downregulation of inflammatory microRNAs by Ig-like transcript 3 is essential for the differentiation of human CD8(+) T suppressor cells. J Immunol. 2012 Apr 1;188(7):3042-52.
REF 8 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 9 MicroRNA-155 functions as an OncomiR in breast cancer by targeting the suppressor of cytokine signaling 1 gene. Cancer Res. 2010 Apr 15;70(8):3119-27.
REF 10 MiR-155 modulates the inflammatory phenotype of intestinal myofibroblasts by targeting SOCS1 in ulcerative colitis. Exp Mol Med. 2015 May 22;47:e164.
REF 11 3B, a novel photosensitizer, inhibits glycolysis and inflammation via miR-155-5p and breaks the JAK/STAT3/SOCS1 feedback loop in human breast cancer cells. Biomed Pharmacother. 2016 Aug;82:141-50.
REF 12 miR-19a promotes cell growth and tumorigenesis through targeting SOCS1 in gastric cancer. Asian Pac J Cancer Prev. 2013;14(2):835-40.
REF 13 Identification of miR-30d as a novel prognostic maker of prostate cancer. Oncotarget. 2012 Nov;3(11):1455-71.
REF 14 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
REF 15 Inhibition of microRNA let-7i depresses maturation and functional state of dendritic cells in response to lipopolysaccharide stimulation via targeting suppressor of cytokine signaling 1. J Immunol. 2011 Aug 15;187(4):1674-83.
REF 16 MiR-122 modulates type I interferon expression through blocking suppressor of cytokine signaling 1. Int J Biochem Cell Biol. 2013 Apr;45(4):858-65.
REF 17 miR-142-5p and miR-130a-3p are regulated by IL-4 and IL-13 and control profibrogenic macrophage program. Nat Commun. 2015 Oct 5;6:8523.
REF 18 MiR-221 accentuates IFNs anti-HCV effect by downregulating SOCS1 and SOCS3. Virology. 2014 Aug;462-463:343-50.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.