Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06046 Target Info
Target Name Nitric-oxide synthase endothelial (NOS3)
Synonyms Nitric oxide synthase, endothelial; NOSIII; NOS,type III; NOS type III; Endothelial nitric oxide synthase; Endothelial NOS; ENOS; EC-NOS; Constitutive NOS; CNOS
Target Type Clinical trial Target
Gene Name NOS3
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
P29474
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 contributes to TNFalpha-induced eNOS downregulation. [1]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-543 miRNA Info
miRNA Mature AC
MIMAT0004954
Sequence aaacauucgcggugcacuucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 1 (FAK) Target Info
FAK1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-335-3p miRNA Info
miRNA Mature AC
MIMAT0004703
Sequence uuuuucauuauugcuccugacc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Nitric-oxide synthase endothelial (NOS3) Target Info
NOS3_HUMAN
References  Top
REF 1 Essential role of microRNA-155 in regulating endothelium-dependent vasorelaxation by targeting endothelial nitric oxide synthase. Hypertension. 2012 Dec;60(6):1407-14.
REF 2 MicroRNA Microarray-Based Identification of Involvement of miR-155 and miR-19a in Development of Oral Lichen Planus (OLP) by Modulating Th1/Th2 Bal... Med Sci Monit. 2018 May 29;24:3591-3603.
REF 3 MicroRNA-155 modulates the proliferation of vascular smooth muscle cells by targeting endothelial nitric oxide synthase. Int J Mol Med. 2015 Jun;35(6):1708-14.
REF 4 Blood hsa-miR-122-5p and hsa-miR-885-5p levels associate with fatty liver and related lipoprotein metabolism-The Young Finns Study. Sci Rep. 2016 Dec 5;6:38262.
REF 5 MicroRNA-335 and -543 suppress bone metastasis in prostate cancer via targeting endothelial nitric oxide synthase. Int J Mol Med. 2015 Nov;36(5):1417-25.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.