Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97141 Target Info
Target Name Myosin light kinase (MYLK)
Synonyms smMLCK; Telokin; Myosin light chain kinase, smooth muscle; MYLK1; MLCK210; MLCK1; MLCK; Kinase-related protein; KRP; Endothelial cell (EC) MLCK isoform; EC mlck; 210,000 molecular weight myosin light chain kinase
Target Type Clinical trial Target
Gene Name MYLK
Biochemical Class Kinase
UniProt ID
Q15746
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 targets myosin light chain kinase (MYLK). [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 In Situ Hybridization [3]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Selective inhibition of the miR-200c resulted in upregulation of MYLK both mRNA levels andprotein level. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MiRNA-155 targets myosin light chain kinase and modulates actin cytoskeleton organization in endothelial cells. Am J Physiol Heart Circ Physiol. 2014 Apr 15;306(8):H1192-203.
REF 2 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 3 MiR-17-92 cluster promotes hepatocarcinogenesis. Carcinogenesis. 2015 Oct;36(10):1213-22.
REF 4 The ZEB1/miR-200c feedback loop regulates invasion via actin interacting proteins MYLK and TKS5. Oncotarget. 2015 Sep 29;6(29):27083-96.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.