Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88752 Target Info
Target Name Ras-related C3 botulinum toxin substrate 1 (RAC1)
Synonyms Cell migration-inducing gene5 protein
Target Type Literature-reported Target
Gene Name RAC1
Biochemical Class Small GTPase
UniProt ID
P63000
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism Protein level of RAC1 the target of miR-122 was altered significantly with transfection of miR-122 [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Microarray; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-142-3p miRNA Info
miRNA Mature AC
MIMAT0000434
Sequence uguaguguuuccuacuuuaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-142-3p downregulates RAC1 expression by targeting the 3' UTR of RAC1. [3]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay [3]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
High mobility group protein B1 (HMGB1) Target Info
HMGB1_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 In Situ Hybridization; Western Blot; Luciferase Reporter Assay; qRT-PCR [5]
2 PAR-CLIP [6]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism RAC1 mRNA and protein expression levels were markedly downregulated by pre-miR-142 transfection. [7]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-224 reduced the luciferase activity of a wild-type reporter but not of a mutant Rac1 30UTR reporter, suggesting that miR-224 directly targets the RAC1 3'UTR. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-574-3p miRNA Info
miRNA Mature AC
MIMAT0003239
Sequence cacgcucaugcacacacccaca
miRNA Species Homo sapiens
Regulation Mechanism miR-574-3p decreased the relative luciferase activities of RAC1. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Histone acetyltransferase p300 (EP300) Target Info
EP300_HUMAN
References  Top
REF 1 The microRNA network and tumor metastasis. Oncogene. 2010 Feb 18;29(7):937-48.
REF 2 Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30.
REF 3 MicroRNA-142-3p, a new regulator of RAC1, suppresses the migration and invasion of hepatocellular carcinoma cells. FEBS Lett. 2011 May 6;585(9):1322-30.
REF 4 MiR-142-3p attenuates the migration of CD4 T cells through regulating actin cytoskeleton via RAC1 and ROCK2 in arteriosclerosis obliterans. PLoS One. 2014 Apr 17;9(4):e95514.
REF 5 miR-146a functions as a tumor suppressor in prostate cancer by targeting Rac1. Prostate. 2014 Dec;74(16):1613-21.
REF 6 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 7 MiR-142 acts as a tumor suppressor in osteosarcoma cell lines by targeting Rac1. Oncol Rep. 2015 Mar;33(3):1291-9.
REF 8 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 9 MicroRNA-224 promotes the sensitivity of osteosarcoma cells to cisplatin by targeting Rac1. J Cell Mol Med. 2016 Sep;20(9):1611-9.
REF 10 Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.