Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T87675 |
Target Info
|
| Target Name |
Aurora kinase A (AURKA) |
| Synonyms |
hARK1; Serine/threonine-protein kinase aurora-A; Serine/threonine-protein kinase 6; Serine/threonine-protein kinase 15; Serine/threonine kinase 15; STK6; STK15; IAK1; Breast tumor-amplified kinase; BTAK; Aurora/IPL1-related kinase 1; Aurora-related kinase 1; Aurora-A; Aurora 2; AYK1; AURA; ARK1; ARK-1; AIRK1; AIK |
| Target Type |
Clinical trial Target |
| Gene Name |
AURKA |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-32-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uauugcacauuacuaaguugca
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
PAR-CLIP |
[2] |
| Representative Target(s) Regulated by This miRNA |
Aurora kinase A (AURKA)
|
Target Info
|
|
|
F-box and WD-40 domain protein 7 (Fbxw7)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-129-1-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagcccuuaccccaaaaaguau
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunoprecipitation; Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Aurora kinase A (AURKA)
|
Target Info
|
|
|
Glycogen synthase kinase-3 beta (GSK-3B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Tanshinones suppress AURKA through up-regulation of miR-32 expression in non-small cell lung cancer. Oncotarget. 2015 Aug 21;6(24):20111-20.
|
| REF 2 |
A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
|
| REF 3 |
Methylation-associated silencing of microRNA-129-3p promotes epithelial-mesenchymal transition, invasion and metastasis of hepatocelluar cancer by targeting Aurora-A. Oncotarget. 2016 Nov 22;7(47):78009-78028.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
