Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T86350 Target Info
Target Name Erbb3 tyrosine kinase receptor (Erbb-3)
Synonyms Tyrosine kinase-type cell surface receptor HER3; Receptor tyrosine-protein kinase erbB-3; Proto-oncogene-like protein c-ErbB-3; HER3; C-erbB3; C-erbB-3 protein
Target Type Clinical trial Target
Gene Name ERBB3
Biochemical Class Kinase
UniProt ID
P21860
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-205-5p resulted in the decreased protein level of target ERBB3. [5]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Microarray; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
6 Western Blot; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125a-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB3. [5]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Microarray; Western Blot [3]
2 Luciferase Reporter Assay; Microarray; Western Blot [5]
3 Western Blot; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 RT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-143-5p miRNA Info
miRNA Mature AC
MIMAT0004599
Sequence ggugcagugcugcaucucuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-143 directly recognized and bound to the 3'UTR of the ERBB3 mRNA transcript and synergistically suppressed ERBB3 expression in breast cancer cells. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; RT-PCR [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Erbb3 tyrosine kinase receptor (Erbb-3) Target Info
ERBB3_HUMAN
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p by mature miRNA transfection resulted in the decreased protein level of target ERBB3. [5]
Evidence Score (E-score) 1 +
1 Western Blot; Northern Blot; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-219a-2-3p miRNA Info
miRNA Mature AC
MIMAT0004675
Sequence agaauuguggcuggacaucugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Erbb3 tyrosine kinase receptor (Erbb-3) Target Info
ERBB3_HUMAN
References  Top
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 2 Suppression of cell growth and invasion by miR-205 in breast cancer. Cell Res. 2009 Apr;19(4):439-48.
REF 3 Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61.
REF 4 microRNA-205 regulates HER3 in human breast cancer. Cancer Res. 2009 Mar 15;69(6):2195-200.
REF 5 Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. J Biol Chem. 2007 Jan 12;282(2):1479-86.
REF 6 Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat-induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells. Cell Death Dis. 2013 Mar 21;4:e556.
REF 7 Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3. J Cancer Res Clin Oncol. 2012 Aug;138(8):1355-61.
REF 8 Control of EVI-1 oncogene expression in metastatic breast cancer cells through microRNA miR-22. Oncogene. 2011 Mar 17;30(11):1290-301.
REF 9 Down-regulation of microRNA-143 is associated with colorectal cancer progression. Eur Rev Med Pharmacol Sci. 2016 Nov;20(22):4682-4687.
REF 10 miR-143 and miR-145 synergistically regulate ERBB3 to suppress cell proliferation and invasion in breast cancer. Mol Cancer. 2014 Sep 24;13:220.
REF 11 Epigenetically silenced microRNAs in gastric cancer: Functional analysis and identification of their target genes. Oncol Rep. 2015 Aug;34(2):1017-26.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.