miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-219a-2-3p | ||||
| miRNA Stemloop AC | MI0000740 | ||||
| miRNA Stemloop ID | hsa-mir-219a-2 | ||||
| Sequence | agaauuguggcuggacaucugu | ||||
| TTD Target(s) Regulated by This miRNA | Erbb3 tyrosine kinase receptor (Erbb-3) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Ankyrin repeat domain-containing protein 13C | Regulated Protein | [1] | ||
| Cancer/testis antigen 62 | Regulated Protein | [1] | |||
| Netrin receptor DCC | Regulated Protein | [1] | |||
| Neuronal migration protein doublecortin | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | Epigenetically silenced microRNAs in gastric cancer: Functional analysis and identification of their target genes. Oncol Rep. 2015 Aug;34(2):1017-26. | ||||
| REF 2 | Epigenetically silenced microRNAs in gastric cancer: Functional analysis and identification of their target genes. Oncol Rep. 2015 Aug;34(2):1017-26. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.