Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T83376 Target Info
Target Name Tumor suppressor candidate 2 (TUSC2)
Synonyms PDGFA-associated protein 2; PDAP2; LGCC; Fusion 1 protein; Fus-1 protein; FUS1; C3orf11
Target Type Clinical trial Target
Gene Name TUSC2
UniProt ID
O75896
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-197-3p miRNA Info
miRNA Mature AC
MIMAT0000227
Sequence uucaccaccuucuccacccagc
miRNA Species Homo sapiens
Regulation Mechanism miR-197 translationally Repress TUSC2 by targeting specific sequences in the 3'UTR of TUSC2. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; RT-PCR [3]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-378a-5p miRNA Info
miRNA Mature AC
MIMAT0000731
Sequence cuccugacuccagguccugugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-378a-5p by mature miRNA precursor transfection resulted in the unchanged mRNA level of target TUSC2; The Underexpression by Underexpression by siRNA Transfection resulted in the increased protein level of target TUSC2. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [4]
2 Luciferase Reporter Assay; Western Blot; qRT-PCR [5]
Representative Target(s) Regulated by This miRNA Nodal homolog (NODAL) Target Info
NODAL_HUMAN
Tumor suppressor candidate 2 (TUSC2) Target Info
TUSC2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-19a can target TUSC2 by binding to TUSC2 mRNA in HEK293 cells. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [5]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 translationally Repress TUSC2 by targeting specific sequences in the 3'UTR of TUSC2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
References  Top
REF 1 miR-93, miR-98, and miR-197 regulate expression of tumor suppressor gene FUS1. Mol Cancer Res. 2009 Aug;7(8):1234-43.
REF 2 MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70.
REF 3 FUS1 acts as a tumor-suppressor gene by upregulating miR-197 in human glioblastoma. Oncol Rep. 2015 Aug;34(2):868-76.
REF 4 MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression. Proc Natl Acad Sci U S A. 2007 Dec 18;104(51):20350-5.
REF 5 Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73.
REF 6 Uncovering Direct Targets of MiR-19a Involved in Lung Cancer Progression. PLoS One. 2015 Sep 14;10(9):e0137887.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.