Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75476 Target Info
Target Name Myeloid differentiation primary response protein MyD88 (MYD88)
Synonyms MyD88
Target Type Literature-reported Target
Gene Name MYD88
UniProt ID
Q99836
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-21 mimics also downregulated GFP gene expression when the 3'UTR of IRAK1 was cloned into the 3'UTR region of GFP in HEK293 cells, as assessed by flow cytometry. [3]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism miR-149 inhibits MYD88 protein expression by directly targeting the 3'UTR of MYD88 mRNA at posttranscriptional level. [5]
Evidence Score (E-score) 1 +
1 ELISA; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism MyD88 mRNA is a target of miR-203. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 Identification of MyD88 as a novel target of miR-155, involved in negative regulation of Helicobacter pylori-induced inflammation. FEBS Lett. 2010 Apr 16;584(8):1481-6.
REF 2 MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 3 HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog. 2013;9(4):e1003248.
REF 4 Enterovirus 71-induced has-miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. Virus Res. 2017 Jun 2;237:27-36.
REF 5 MicroRNA-149 negatively regulates TLR-triggered inflammatory response in macrophages by targeting MyD88. J Cell Biochem. 2014 May;115(5):919-27.
REF 6 MyD88 as a target of microRNA-203 in regulation of lipopolysaccharide or Bacille Calmette-Guerin induced inflammatory response of macrophage RAW264.7 cells. Mol Immunol. 2013 Oct;55(3-4):303-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.