Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T69121 Target Info
Target Name Integrin alpha-6 (ITGA6)
Synonyms VLA-6 integrin; VLA-6; CD49f; CD49 antigen-like family member F; Alpha6 beta1 integrin
Target Type Literature-reported Target
Gene Name ITGA6
Biochemical Class Integrin
UniProt ID
P23229
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-140-3p miRNA Info
miRNA Mature AC
MIMAT0004597
Sequence uaccacaggguagaaccacgg
miRNA Species Homo sapiens
Regulation Mechanism ITGA6 is a direct target of the miR-140-3p. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cyclic ADP-ribose hydrolase 1 (CD38) Target Info
CD38_HUMAN
Fibronectin (FN1) Target Info
FINC_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity in the cells transfected with ITGA6-3' UTR was reduced significantly by miR-92b compared with the control cells whereas luciferase activity in the cells transfected with ITGA6-3'TR-mut was restored relative to the cells transfected with ITGA6-3' UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
References  Top
REF 1 Tumour-suppressive microRNA-29s inhibit cancer cell migration and invasion by targeting laminin-integrin signalling in head and neck squamous cell carcinoma. Br J Cancer. 2013 Nov 12;109(10):2636-45.
REF 2 Inhibition of integrin 1-mediated oncogenic signalling by the antitumor microRNA-29 family in head and neck squamous cell carcinoma. Oncotarget. 2017 Dec 11;9(3):3663-3676.
REF 3 The highly expressed 5'isomiR of hsa-miR-140-3p contributes to the tumor-suppressive effects of miR-140 by reducing breast cancer proliferation and migration. BMC Genomics. 2016 Aug 8;17:566.
REF 4 Integrin 6 promotes esophageal cancer metastasis and is targeted by miR-92b. Oncotarget. 2017 Jan 24;8(4):6681-6690.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.