Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63816 Target Info
Target Name Histone deacetylase 4 (HDAC4)
Synonyms KIAA0288; HD4
Target Type Clinical trial Target
Gene Name HDAC4
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
P56524
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-1-3p by mature miRNA precursor transfection resulted in the decreased protein level of target HDAC4. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-125a-5p decreased HDAC4 protein level. [3]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-140-5p miRNA Info
miRNA Mature AC
MIMAT0000431
Sequence cagugguuuuacccuaugguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-140-5p resulted in the decreased protein level of target HDAC4. [2]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot; Luciferase Reporter Assay [5]
2 qRT-PCR; Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Adenosine deaminase (ADA) Target Info
ADA_HUMAN
Aspartyl aminopeptidase (DNPEP) Target Info
DNPEP_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism HDAC4 is upregulated in miR-22-downregulated HCC tissues. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism The anti-metastasis effect of miR-206 is mediated by targeting metastasis regulatory gene HDAC4. [8]
Evidence Score (E-score) 1 +
1 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism The direct target of hsa-miR-302b is HDAC4 gene. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-365a-3p miRNA Info
miRNA Mature AC
MIMAT0000710
Sequence uaaugccccuaaaaauccuuau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-365a-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target HDAC4. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-675-5p miRNA Info
miRNA Mature AC
MIMAT0004284
Sequence uggugcggagagggcccacagug
miRNA Species Homo sapiens
Regulation Mechanism miR-675 bound directly to the 3'UTR of HDAC4 and downregulated its mRNA and protein levels. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA G-protein coupled receptor 55 (GPR55) Target Info
GPR55_HUMAN
Histone deacetylase 4 (HDAC4) Target Info
HDAC4_HUMAN
miRNA Mature ID hsa-miR-381-3p miRNA Info
miRNA Mature AC
MIMAT0000736
Sequence uauacaagggcaagcucucugu
miRNA Species Homo sapiens
Regulation Mechanism miR-381 targets HDAC4. [11]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Western Blot [11]
Representative Target(s) Regulated by This miRNA Calcium-dependent chloride channel anoctamin (ANO) Target Info
ANO1_HUMAN
Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
References  Top
REF 1 The expression and regulation of miR-1 in goat skeletal muscle and satellite cell during muscle growth and development. Anim Biotechnol. 2019 Jun 10:1-8.
REF 2 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 3 miR-125a-5p is a prognostic biomarker that targets HDAC4 to suppress breast tumorigenesis. Oncotarget. 2015 Jan 1;6(1):494-509.
REF 4 Interfering histone deacetylase 4 inhibits the proliferation of vascular smooth muscle cells via regulating MEG3/miR-125a-5p/IRF1. Cell Adh Migr. 2019 Dec;13(1):41-49.
REF 5 Mechanism of chemoresistance mediated by miR-140 in human osteosarcoma and colon cancer cells. Oncogene. 2009 Nov 19;28(46):4065-74.
REF 6 MicroRNA-22 (miR-22) overexpression is neuroprotective via general anti-apoptotic effects and may also target specific Huntington's disease-related mechanisms. PLoS One. 2013;8(1):e54222.
REF 7 microRNA-22, downregulated in hepatocellular carcinoma and correlated with prognosis, suppresses cell proliferation and tumourigenicity. Br J Cancer. 2010 Oct 12;103(8):1215-20.
REF 8 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 9 Increased sensitivity to chemotherapy induced by CpG-ODN treatment is mediated by microRNA modulation. PLoS One. 2013;8(3):e58849.
REF 10 Long Non-coding RNA H19 Inhibits Adipocyte Differentiation of Bone Marrow Mesenchymal Stem Cells through Epigenetic Modulation of Histone Deacetylases. Sci Rep. 2016 Jun 28;6:28897.
REF 11 MicroRNA-381 Regulates Chondrocyte Hypertrophy by Inhibiting Histone Deacetylase 4 Expression. Int J Mol Sci. 2016 Aug 23;17(9). pii: E1377.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.