Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T60631 Target Info
Target Name Proto-oncogene c-Ret (RET)
Synonyms RET51; RET receptor tyrosine kinase; RET mutant Y791F; RET mutant V804M; RET mutant V804L; RET mutant S891A; RET mutant M918T; RET mutant G691S; Proto-oncogene tyrosine-protein kinase receptor Ret; PTC; Cadherin family member 12; CDHR16; CDHF12; C-ret
Target Type Successful Target
Gene Name RET
Biochemical Class Kinase
UniProt ID
P07949
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-15a downregulated Renilla translation by binding to the RET 3'UTR region indicating that RET is a target of these miR-15a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-195-5p downregulated Renilla translation by binding to the RET 3'UTR region indicating that RET is a target of miR-195-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism miR-27b downregulated Renilla translation by binding to the RET 3'UTR region indicating that RET is a target of these miR-27b. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29 targets RET and RET was significantly upregulated in DM1 patients. [2]
Evidence Score (E-score) 1 +
1 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 Acute myeloid leukemia with translocation (8;16)(p11;p13) and MYST3-CREBBP rearrangement harbors a distinctive microRNA signature targeting RET proto-oncogene. Leukemia. 2013 Mar;27(3):595-603.
REF 2 Dysregulation and cellular mislocalization of specific miRNAs in myotonic dystrophy type 1. Neuromuscul Disord. 2011 Feb;21(2):81-8.
REF 3 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.