Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T56510 Target Info
Target Name Apoptosis regulator Bcl-xL (BCL-xL)
Synonyms Bcl2like protein 1; Bcl2L1; Bcl2-L-1; Bcl-XL; Bcl-2-like protein 1; BCLX; BCL2L; Apoptosis regulator Bcl-X
Target Type Clinical trial Target
Gene Name BCL2L1
Biochemical Class B-cell lymphoma Bcl-2
UniProt ID
Q07817
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-491-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target BCL2L1. [4]
Evidence Score (E-score) 4 +
1 GFP Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; Western Blot [3]
4 Reporter Assay; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7c led to a clear decrease of Bcl-xL expression in Huh7 and HepG2 cel lines. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-324-3p miRNA Info
miRNA Mature AC
MIMAT0000762
Sequence cccacugccccaggugcugcugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [7]
2 PAR-CLIP [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
CREB-binding protein (CREBBP) Target Info
CBP_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of let-7g led to a clear decrease of Bcl-xL expression in Huh7 and HepG2 cel lines. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b-3p acts as a tumor suppressor in gastric cancer by directly targeting Bcl-xl. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism miR-326 interacts directly with the 3'UTR of Bcl-xL. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-608 miRNA Info
miRNA Mature AC
MIMAT0003276
Sequence aggggugguguugggacagcuccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-608 directly regulates BCL2L1 expression by binding to the 3'UTR. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 MicroRNA miR-491-5p targeting both TP53 and Bcl-XL induces cell apoptosis in SW1990 pancreatic cancer cells through mitochondria mediated pathway. Molecules. 2012 Dec 11;17(12):14733-47.
REF 2 Two mature products of MIR-491 coordinate to suppress key cancer hallmarks in glioblastoma. Oncogene. 2015 Mar 26;34(13):1619-1628.
REF 3 Functional screening identifies a microRNA, miR-491 that induces apoptosis by targeting Bcl-X(L) in colorectal cancer cells. Int J Cancer. 2010 Sep 1;127(5):1072-80.
REF 4 miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20.
REF 5 MicroRNA let-7c inhibits Bcl-xl expression and regulates ox-LDL-induced endothelial apoptosis. BMB Rep. 2012 Aug;45(8):464-9.
REF 6 The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. J Hepatol. 2010 May;52(5):698-704.
REF 7 The IL-4/STAT6 signaling axis establishes a conserved microRNA signature in human and mouse macrophages regulating cell survival via miR-342-3p. Genome Med. 2016 May 31;8(1):63.
REF 8 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 9 Identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer. Cancer Lett. 2015 Dec 1;369(1):58-66.
REF 10 miR-326 targets antiapoptotic Bcl-xL and mediates apoptosis in human platelets. PLoS One. 2015 Apr 13;10(4):e0122784.
REF 11 MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis. Exp Cell Res. 2015 Dec 10;339(2):320-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.