Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T47164 |
Target Info
|
| Target Name |
MST-1 protein kinase (STK4) |
| Synonyms |
Serine/threonine-protein kinase Krs-2; Serine/threonine-protein kinase 4 18kDa subunit; Serine/threonine-protein kinase 4; STE20-like kinase MST1; Mammalian STE20-like protein kinase 1; MST1/N; MST1/C; MST1; MST-1; KRS2 |
| Target Type |
Literature-reported Target |
| Gene Name |
STK4 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaaggugcaucuagugcagauag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The luciferase activity in HEK-293T and DU-145 cells transfected with STK4 wild type constructs plus miR-18a mimics was significantly lower than that in cells transfected with the control miR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-373-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gaagugcuucgauuuuggggugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Microarray |
[2] |
| Representative Target(s) Regulated by This miRNA |
B-cell translocation gene 1 protein (BTG1)
|
Target Info
|
|
|
Cell surface protein HB15 (CD83)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-18a is elevated in prostate cancer and promotes tumorigenesis through suppressing STK4 in vitro and in vivo. Oncogenesis. 2014 Apr 21;3:e99.
|
| REF 2 |
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005 Feb 17;433(7027):769-73.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
