Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29741 Target Info
Target Name NADPH oxidase 4 (NOX4)
Synonyms Renal NAD(P)Hoxidase; Renal NAD(P)H-oxidase; RENOX; Kidney superoxideproducing NADPH oxidase; Kidney superoxide-producing NADPH oxidase; Kidney oxidase1; Kidney oxidase-1; KOX1; KOX-1
Target Type Clinical trial Target
Gene Name NOX4
Biochemical Class NADH/NADPH oxidoreductase
UniProt ID
Q9NPH5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism NOX4 is a target of miR-99a. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-182-3p miRNA Info
miRNA Mature AC
MIMAT0000260
Sequence ugguucuagacuugccaacua
miRNA Species Homo sapiens
Regulation Mechanism NOX4 Is Directly Targeted by miR-182 and the mutation of the perfectly miR-182 complementary site in the 3' UTR of NOX4 (TGCCAAA ACGGTTT) abolished the suppressive effect of miR-182 through the disruption of the interaction between miR-182 and NOX4. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
NADPH oxidase 4 (NOX4) Target Info
NOX4_HUMAN
miRNA Mature ID hsa-miR-99b-5p miRNA Info
miRNA Mature AC
MIMAT0000689
Sequence cacccguagaaccgaccuugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-99b can directly bind to the 3'UTR of NOX4 mRNA and potentially downregulate its protein expression. [4]
Evidence Score (E-score) 1 +
1 ELISA [4]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
NADPH oxidase 4 (NOX4) Target Info
NOX4_HUMAN
References  Top
REF 1 MiR-99a regulates ROS-mediated invasion and migration of lung adenocarcinoma cells by targeting NOX4. Oncol Rep. 2016 May;35(5):2755-66.
REF 2 MiR-99a-5p regulates proliferation, migration and invasion abilities of human oral carcinoma cells by targeting NOX4. Neoplasma. 2017;64(5):666-673.
REF 3 microRNA-182 Mediates Sirt1-Induced Diabetic Corneal Nerve Regeneration. Diabetes. 2016 Jul;65(7):2020-31.
REF 4 Chronic administration of 9-tetrahydrocannabinol induces intestinal anti-inflammatory microRNA expression during acute simian immunodeficiency virus infection of rhesus macaques. J Virol. 2015 Jan 15;89(2):1168-81.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.