Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29143 Target Info
Target Name Interleukin-13 (IL13)
Synonyms NC30; IL-13
Target Type Successful Target
Gene Name IL13
Biochemical Class Cytokine: interleukin
UniProt ID
P35225
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7d-5p miRNA Info
miRNA Mature AC
MIMAT0000065
Sequence agagguaguagguugcauaguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7d targets IL13 3 ' UTR. [2]
Evidence Score (E-score) 2 +
1 ELISA [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Divalent metal transporter 1 (SLC11A2) Target Info
NRAM2_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7g targets IL13 3 ' UTR. [2]
Evidence Score (E-score) 2 +
1 ELISA [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7i-5p miRNA Info
miRNA Mature AC
MIMAT0000415
Sequence ugagguaguaguuugugcuguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7i targets IL13 3 ' UTR. [2]
Evidence Score (E-score) 2 +
1 ELISA [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
Bone morphogenetic protein 4 (BMP4) Target Info
BMP4_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism miR-98 targets IL13 3 'UTR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 RT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
References  Top
REF 1 Autocrine role of interleukin-13 on skeletal muscle glucose metabolism in type 2 diabetic patients involves microRNA let-7. Am J Physiol Endocrinol Metab. 2013 Dec 1;305(11):E1359-66.
REF 2 Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation. J Allergy Clin Immunol. 2011 Nov;128(5):1077-85.e1-10.
REF 3 Micro RNA-98 interferes with expression interleukin-10 in peripheral B cells of patients with lung cancer. Sci Rep. 2016 Sep 8;6:32754.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.