Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T23619 Target Info
Target Name Metastasis associated gene-1 (MTA1)
Synonyms Metastasisassociated protein MTA1; Metastasis-associated protein MTA1
Target Type Literature-reported Target
Gene Name MTA1
UniProt ID
Q13330
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-125a-3p was a regulator of MTA1 expression through interaction with its 3'UTR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
miRNA Mature ID hsa-miR-661 miRNA Info
miRNA Mature AC
MIMAT0003324
Sequence ugccugggucucuggccugcgcgu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-661 resulted in the decreased protein level of target MTA1. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot; Immunohistochemistry [4]
Representative Target(s) Regulated by This miRNA Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) Target Info
MCL1_HUMAN
Metastasis associated gene-1 (MTA1) Target Info
MTA1_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The expreesion of MTA1 is positively correlated with miR-22, supporting their inhibitory effect on E-cadherin expression. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-543 miRNA Info
miRNA Mature AC
MIMAT0004954
Sequence aaacauucgcggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-543 suppresses colorectal cancer growth and metastasis by targeting MTA1. [6]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 1 (FAK) Target Info
FAK1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-559 miRNA Info
miRNA Mature AC
MIMAT0003223
Sequence uaaaguaaauaugcaccaaaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-559 resulted in the decreased protein level of target MTA1. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
Metastasis associated gene-1 (MTA1) Target Info
MTA1_HUMAN
References  Top
REF 1 Regulation of Docetaxel Sensitivity in Prostate Cancer Cells by hsa-miR-125a-3p via Modulation of Metastasis-Associated Protein 1 Signaling. Urology. 2017 Jul;105:208.e11-208.e17.
REF 2 miR-125a-3p targets MTA1 to suppress NSCLC cell proliferation, migration, and invasion. Acta Biochim Biophys Sin (Shanghai). 2015 Jul;47(7):496-503.
REF 3 MicroRNA-661, a c/EBPalpha target, inhibits metastatic tumor antigen 1 and regulates its functions. Cancer Res. 2009 Jul 15;69(14):5639-42.
REF 4 Upregulation of circ-UBAP2 predicts poor prognosis and promotes triple-negative breast cancer progression through the miR-661/MTA1 pathway. Biochem Biophys Res Commun. 2018 Nov 10;505(4):996-1002.
REF 5 MTA1-activated Epi-microRNA-22 regulates E-cadherin and prostate cancer invasiveness. FEBS Lett. 2017 Mar;591(6):924-933.
REF 6 MicroRNA-543 suppresses colorectal cancer growth and metastasis by targeting KRAS, MTA1 and HMGA2. Oncotarget. 2016 Apr 19;7(16):21825-39.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.