Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21580 Target Info
Target Name GTPase activating protein (RASA1)
Synonyms p120GAP; RasGAP; Ras p21 protein activator; Ras GTPase-activating protein 1; RASA; GTPase-activating protein; GAP
Target Type Literature-reported Target
Gene Name RASA1
UniProt ID
P20936
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-335 may be silenced by promoter hypermethylation and play important roles in gastric cell invasion and metastasis through its target genes such as RASA1. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism Luciferase reporter gene assay verified RASA1 is a target of miR?21. Significantly higher RASA1 mRNA and protein levels were observed in anti?miR?21?LV cells (P < 0.05). [5]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [4]
2 Luciferase Reporter Assay; Western Blot [5]
3 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 stimulates colorectal cancer cell proliferation and tumorigenesis by directly targeting RASA1. [9]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
3 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; Western Blot [10]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [11]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
References  Top
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.
REF 2 Overexpression of miR-335 confers cell proliferation and tumour growth to colorectal carcinoma cells. Mol Cell Biochem. 2016 Jan;412(1-2):235-45.
REF 3 Methylation-associated silencing of MicroRNA-335 contributes tumor cell invasion and migration by interacting with RASA1 in gastric cancer. Am J Cancer Res. 2014 Nov 19;4(6):648-62.
REF 4 Fusobacterium nucleatum Increases Proliferation of Colorectal Cancer Cells and Tumor Development in Mice by Activating Toll-Like Receptor 4 Signaling to Nuclear Factor-B, and Up-regulating Expression of MicroRNA-21. Gastroenterology. 2017 Mar;152(4):851-866.e24.
REF 5 MiR-21/RASA1 axis affects malignancy of colon cancer cells via RAS pathways. World J Gastroenterol. 2015 Feb 7;21(5):1488-97.
REF 6 MicroRNA-21 promotes cell transformation by targeting the programmed cell death 4 gene. Oncogene. 2008 Jul 17;27(31):4373-9.
REF 7 Transcriptional Regulation of miR-31 by Oncogenic KRAS Mediates Metastatic Phenotypes by Repressing RASA1. Mol Cancer Res. 2016 Mar;14(3):267-77.
REF 8 MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer. J Clin Invest. 2016 Jan;126(1):349-64.
REF 9 MicroRNA-31 activates the RAS pathway and functions as an oncogenic MicroRNA in human colorectal cancer by repressing RAS p21 GTPase activating protein 1 (RASA1). J Biol Chem. 2013 Mar 29;288(13):9508-18.
REF 10 Transplantation of human pericyte progenitor cells improves the repair of infarcted heart through activation of an angiogenic program involving micro-RNA-132. Circ Res. 2011 Sep 30;109(8):894-906.
REF 11 MicroRNA-214 is aberrantly expressed in cervical cancers and inhibits the growth of HeLa cells. IUBMB Life. 2009 Nov;61(11):1075-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.