Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T19852 | Target Info | |||
| Target Name | Keratinocyte growth factor (FGF7) | ||||
| Synonyms | KGF; Heparin-binding growth factor 7; HBGF-7; Fibroblast growth factor 7; FGF-7 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | FGF7 | ||||
| Biochemical Class | Growth factor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuaaucgugauagggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | FGF7 is a functional target of miR-155. | [3] | |||
| Evidence Score (E-score) | 3 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| 3 | Proteomics | [3] | |||
| Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
| Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-15a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uagcagcacauaaugguuugug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | FGF7 is a potential target of miR-15a. | [4] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [4] | |||
| Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Identification of keratinocyte growth factor as a target of microRNA-155 in lung fibroblasts: implication in epithelial-mesenchymal interactions. PLoS One. 2009 Aug 24;4(8):e6718. | ||||
| REF 2 | Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009 Feb;11(2):167-76. | ||||
| REF 3 | Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63. | ||||
| REF 4 | Dysregulation of miR-15a and miR-214 in human pancreatic cancer. J Hematol Oncol. 2010 Nov 24;3:46. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.