Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15510 Target Info
Target Name Insulin receptor substrate-1 (IRS1)
Synonyms Insulin receptor substrate 1; IRS-1
Target Type Clinical trial Target
Gene Name IRS1
UniProt ID
P35568
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-126-3p resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 8 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Microarray; qRT-PCR; Western Blot [7]
8 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-145-5p by mature miRNA transfection resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 8 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
4 Luciferase Reporter Assay; Western Blot [12]
5 qRT-PCR; In Situ Hybridization; Western Blot [13]
6 qRT-PCR; Western Blot [14]
7 qRT-PCR; Western Blot [15]
8 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism Insulin receptor substrate 1 (IRS1) is a direct target of miR-144. [16]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [16]
2 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-223-3p resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 2 +
1 Western Blot [3]
2 Western Blot [17]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a directly targets IRS 1 in BC cells. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 directly targets IRS 1 in BC cells. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
MIMAT0000252
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
ACK1_HUMAN
Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-96-5p resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-217-5p miRNA Info
miRNA Mature AC
MIMAT0000274
Sequence uacugcaucaggaacugauugga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-217-5p resulted in the decreased protein level of target IRS1. [3]
Evidence Score (E-score) 1 +
1 Western Blot [3]
Representative Target(s) Regulated by This miRNA Insulin receptor substrate-1 (IRS1) Target Info
IRS1_HUMAN
Orphan nuclear receptor NURR1 (NR4A2) Target Info
NR4A2_HUMAN
miRNA Mature ID hsa-miR-384 miRNA Info
miRNA Mature AC
MIMAT0001075
Sequence auuccuagaaauuguucaua
miRNA Species Homo sapiens
Regulation Mechanism miR-384 directly targets IRS1 by binding to its 3'UTR and altered levels of proteins related to cell proliferation in HepG2 cells. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-1225-5p miRNA Info
miRNA Mature AC
MIMAT0005572
Sequence guggguacggcccagugggggg
miRNA Species Homo sapiens
Regulation Mechanism Insulin receptor substrate 1 (IRS1) as a downstream effector of miR-1225-5p which acted through B-catenin signaling pathway. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Insulin receptor substrate-1 (IRS1) Target Info
IRS1_HUMAN
miRNA Mature ID hsa-miR-628-5p miRNA Info
miRNA Mature AC
MIMAT0004809
Sequence augcugacauauuuacuagagg
miRNA Species Homo sapiens
Regulation Mechanism The level of miR-628, a potential regulator of IRS1 protein translation, were clearly elevated. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Insulin receptor substrate-1 (IRS1) Target Info
IRS1_HUMAN
References  Top
REF 1 Downregulation of miR-362-5p inhibits proliferation, migration and invasion of human breast cancer MCF7 cells. Oncol Lett. 2016 Feb;11(2):1155-1160.
REF 2 The induction of microRNA targeting IRS-1 is involved in the development of insulin resistance under conditions of mitochondrial dysfunction in hepatocytes. PLoS One. 2011 Mar 25;6(3):e17343.
REF 3 Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90.
REF 4 Regulation of vascular smooth muscle cell turnover by endothelial cell-secreted microRNA-126: role of shear stress. Circ Res. 2013 Jun 21;113(1):40-51.
REF 5 MicroRNA-126 acts as a tumor suppressor in glioma cells by targeting insulin receptor substrate 1 (IRS-1). Int J Clin Exp Pathol. 2015 Sep 1;8(9):10345-54.
REF 6 MicroRNA-126-mediated control of cell fate in B-cell myeloid progenitors as a potential alternative to transcriptional factors. Proc Natl Acad Sci U S A. 2013 Aug 13;110(33):13410-5.
REF 7 MicroRNA-126 induces autophagy by altering cell metabolism in malignant mesothelioma. Oncotarget. 2016 Jun 14;7(24):36338-36352.
REF 8 The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun. 2008 Dec 5;377(1):136-40.
REF 9 MiR-145 modulates multiple components of the insulin-like growth factor pathway in hepatocellular carcinoma. Carcinogenesis. 2012 Jun;33(6):1134-41.
REF 10 MicroRNA-145 suppresses hepatocellular carcinoma by targeting IRS1 and its downstream Akt signaling. Biochem Biophys Res Commun. 2014 Apr 18;446(4):1255-60.
REF 11 Deregulated expression of miR-145 in manifold human cancer cells. Exp Mol Pathol. 2013 Aug;95(1):91-7.
REF 12 Downregulation of miR-145 associated with cancer progression and VEGF transcriptional activation by targeting N-RAS and IRS1. Biochim Biophys Acta. 2013 Feb;1829(2):239-47.
REF 13 Tumor suppressors miR-143 and miR-145 and predicted target proteins API5, ERK5, K-RAS, and IRS-1 are differentially expressed in proximal and distal colon. Am J Physiol Gastrointest Liver Physiol. 2015 Feb 1;308(3):G179-87.
REF 14 Decreased expression of microRNA-143 and -145 in human gastric cancers. Oncology. 2009;77(1):12-21.
REF 15 Mechanism of growth inhibition by MicroRNA 145: the role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009 Aug;220(2):485-91.
REF 16 miR-144 suppresses the growth and metastasis of laryngeal squamous cell carcinoma by targeting IRS1. Am J Transl Res. 2016 Jan 15;8(1):1-11.
REF 17 Biomarkers Associated with Ischemic Stroke in Diabetes Mellitus Patients. Cardiovasc Toxicol. 2016 Jul;16(3):213-22.
REF 18 A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1. J Mol Cell Biol. 2013 Feb;5(1):3-13.
REF 19 MiR-384 regulated IRS1 expression and suppressed cell proliferation of human hepatocellular carcinoma. Tumour Biol. 2016 Oct;37(10):14165-14171.
REF 20 MicroRNA-1225-5p inhibits proliferation and metastasis of gastric carcinoma through repressing insulin receptor substrate-1 and activation of -catenin signaling. Oncotarget. 2016 Jan 26;7(4):4647-63.
REF 21 miR-628 Promotes Burn-Induced Skeletal Muscle Atrophy via Targeting IRS1. Int J Biol Sci. 2016 Sep 15;12(10):1213-1224.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.