miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-217-5p | ||||
| miRNA Stemloop AC | MI0000293 | ||||
| miRNA Stemloop ID | hsa-mir-217 | ||||
| Sequence | uacugcaucaggaacugauugga | ||||
| TTD Target(s) Regulated by This miRNA | Orphan nuclear receptor NURR1 (NR4A2) | Literature-reported Target | Target Info | [1] | |
| Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102. | ||||
| REF 2 | Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.