Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T11288 Target Info
Target Name Multidrug resistance-associated protein 1 (ABCC1)
Synonyms MRP1; MRP; Leukotriene C(4) transporter; LTC4 transporter; ATP-binding cassette sub-family C member 1
Target Type Successful Target
Gene Name ABCC1
Biochemical Class ABC transporter
UniProt ID
P33527
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-1291 miRNA Info
miRNA Mature AC
MIMAT0005881
Sequence uggcccugacugaagaccagcagu
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-1291directed downregulation of ABCC1 led to a greater intracellular drug accumulation and sensitized the cells to doxorubicin. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 RT-PCR [4]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum to nucleus signaling 1 (ERN1) Target Info
ERN1_HUMAN
HepG2 glucose transporter (SLC2A1) Target Info
GTR1_HUMAN
miRNA Mature ID hsa-miR-134-5p miRNA Info
miRNA Mature AC
MIMAT0000447
Sequence ugugacugguugaccagagggg
miRNA Species Homo sapiens
Regulation Mechanism ABCC1 is negatively regulated by miR-134 and down-regulation of ABCC1 at the protein level largely correlates with elevated levels of miR-134 in H69AR cells. [5]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot; Northern Blot [5]
Representative Target(s) Regulated by This miRNA Angiopoietin-related protein 4 (ANGPTL4) Target Info
ANGL4_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-345-5p miRNA Info
miRNA Mature AC
MIMAT0000772
Sequence gcugacuccuaguccagggcuc
miRNA Species Homo sapiens
Regulation Mechanism Transfection of the HEK293 cells with miR-7 significantly inhibited luciferase activity from the construct with the MRP1-3'UTR segment. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Multidrug resistance-associated protein 1 (ABCC1) Target Info
MRP1_HUMAN
References  Top
REF 1 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
REF 2 Identification of miR-145 targets through an integrated omics analysis. Mol Biosyst. 2015 Jan;11(1):197-207.
REF 3 Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013 Oct;41(10):1744-51.
REF 4 Chimeric MicroRNA-1291 Biosynthesized Efficiently in Escherichia coli Is Effective to Reduce Target Gene Expression in Human Carcinoma Cells and Im... Drug Metab Dispos. 2015 Jul;43(7):1129-36.
REF 5 Gene expression profiling of drug-resistant small cell lung cancer cells by combining microRNA and cDNA expression analysis. Eur J Cancer. 2010 Jun;46(9):1692-702.
REF 6 Alterations of microRNAs and their targets are associated with acquired resistance of MCF-7 breast cancer cells to cisplatin. Int J Cancer. 2010 Oct 15;127(8):1785-94.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.