miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-1291 | ||||
miRNA Stemloop AC | MI0006353 | ||||
miRNA Stemloop ID | hsa-mir-1291 | ||||
Sequence | uggcccugacugaagaccagcagu | ||||
TTD Target(s) Regulated by This miRNA | Multidrug resistance-associated protein 1 (ABCC1) | Successful Target | Target Info | [1] | |
Endoplasmic reticulum to nucleus signaling 1 (ERN1) | Clinical trial Target | Target Info | [2] | ||
HepG2 glucose transporter (SLC2A1) | Preclinical Target | Target Info | [3] | ||
References | |||||
REF 1 | Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013 Oct;41(10):1744-51. | ||||
REF 2 | MicroRNA-1291-mediated silencing of IRE1 enhances Glypican-3 expression. RNA. 2013 Jun;19(6):778-88. | ||||
REF 3 | Tumor-suppressive microRNA-1291 directly regulates glucose transporter 1 in renal cell carcinoma. Cancer Sci. 2013 Nov;104(11):1411-9. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.