Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07766 Target Info
Target Name PAK-2 protein kinase (PAK2)
Synonyms p21-activated kinase 2; Serine/threonine-protein kinase PAK 2; S6/H4 kinase; PAK65; PAK-2; Gamma-PAK
Target Type Literature-reported Target
Gene Name PAK2
Biochemical Class Kinase
UniProt ID
Q13177
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-134-5p miRNA Info
miRNA Mature AC
MIMAT0000447
Sequence ugugacugguugaccagagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-134 directly targets PAK2 CDS region. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Angiopoietin-related protein 4 (ANGPTL4) Target Info
ANGL4_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-224 resulted in decreased mRNA level of PAK2. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 PAK2 promotes migration and proliferation of salivary gland adenoid cystic carcinoma. Am J Transl Res. 2016 Aug 15;8(8):3387-97.
REF 2 Down-regulated expression of miR-134 contributes to paclitaxel resistance in human ovarian cancer cells. FEBS Lett. 2015 Oct 7;589(20 Pt B):3154-64.
REF 3 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 4 Involvement of microRNA-224 in cell proliferation, migration, invasion, and anti-apoptosis in hepatocellular carcinoma. J Gastroenterol Hepatol. 2013 Mar;28(3):565-75.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.