Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T04773 Target Info
Target Name Stromal cell-derived factor 1 (CXCL12)
Synonyms hSDF-1; SDF1B; SDF1A; SDF1; SDF-1; Pre-B cell growth-stimulating factor; Pre-B cell growth stimulating factor; PBSF; Intercrine reduced in hepatomas; IRH; HIRH; C-X-C motif chemokine 12
Target Type Clinical trial Target
Gene Name CXCL12
Biochemical Class Cytokine: CXC chemokine
UniProt ID
P48061
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 may act in synergy for maximal effect to suppress Sdf-1alpha production. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism The direct repression of CXCL12 can caused by miR-146a-5p. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-126-5p miRNA Info
miRNA Mature AC
MIMAT0000444
Sequence cauuauuacuuuugguacgcg
miRNA Species Homo sapiens
Regulation Mechanism miR-126 may act in synergy for maximal effect to suppress Sdf-1alpha production. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-7 (MMP-7) Target Info
MMP7_HUMAN
Proto-oncogene c-Crk (c-Crk) Target Info
CRK_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism SDF1 was identified as the target of miR-212- 3p Overexpression of miR-193a-3p significantly reduced the luciferase activity of the reporter gene in wild type, but not mutant. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-448 miRNA Info
miRNA Mature AC
MIMAT0001532
Sequence uugcauauguaggaugucccau
miRNA Species Homo sapiens
Regulation Mechanism CXCL12 was a target gene of miR-448 in ovarian cancer cells. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ERK activator kinase 1 (MEK1) Target Info
MP2K1_HUMAN
miRNA Mature ID hsa-miR-454-3p miRNA Info
miRNA Mature AC
MIMAT0003885
Sequence uagugcaauauugcuuauagggu
miRNA Species Homo sapiens
Regulation Mechanism Promoter luciferase assay con rmed that bindings of miR-454 to 3'UTR of SDF-1 mRNAs inhibited SDF-1 protein translation. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; ELISA [9]
Representative Target(s) Regulated by This miRNA Stromal cell-derived factor 1 (CXCL12) Target Info
SDF1_HUMAN
References  Top
REF 1 miR-126 and miR-126* repress recruitment of mesenchymal stem cells and inflammatory monocytes to inhibit breast cancer metastasis. Nat Cell Biol. 2013 Mar;15(3):284-94.
REF 2 Delivery of microRNA-126 by apoptotic bodies induces CXCL12-dependent vascular protection. Sci Signal. 2009 Dec 8;2(100):ra81.
REF 3 miR-146a-5p circuitry uncouples cell proliferation and migration, but not differentiation, in human mesenchymal stem cells. Nucleic Acids Res. 2013 Nov;41(21):9753-63.
REF 4 Functions of miR-146a and miR-222 in Tumor-associated Macrophages in Breast Cancer. Sci Rep. 2015 Dec 22;5:18648.
REF 5 Downregulation of miR-221-3p contributes to IL-1-induced cartilage degradation by directly targeting the SDF1/CXCR4 signaling pathway. J Mol Med (Berl). 2017 Jun;95(6):615-627.
REF 6 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 7 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 8 miR-448 negatively regulates ovarian cancer cell growth and metastasis by targeting CXCL12. Clin Transl Oncol. 2015 Nov;17(11):903-9.
REF 9 MicroRNA-454 regulates stromal cell derived factor-1 in the control of the growth of pancreatic ductal adenocarcinoma. Sci Rep. 2016 Mar 15;6:22793.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.