Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T02677 Target Info
Target Name Apoptosis inhibitor survivin (BIRC5)
Synonyms Survivin; IAP4; Baculoviral IAP repeat-containing protein 5; Apoptosis inhibitor 4; API4
Target Type Clinical trial Target
Gene Name BIRC5
Biochemical Class Acyltransferase
UniProt ID
O15392
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection with the miR-203 precursor was found to decrease wild type BIRC5 3'UTR reporter activity. [4]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [6]
2 qRT-PCR; Luciferase Reporter Assay; Immunohistochemistry; Western Blot [7]
3 qRT-PCR; Western Blot [8]
4 qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-542-3p miRNA Info
miRNA Mature AC
MIMAT0003389
Sequence ugugacagauugauaacugaaa
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [10]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [11]
3 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Angiopoietin-2 (ANGPT2) Target Info
ANGP2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [13]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [10]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Regulation Mechanism SNP rs2239680 affects the interaction between miR-335 and the 3 ' UTR of BIRC5. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [14]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism BIRC5 is directly targeted by miR-195. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-494 significantly decreased the protein expression of BIRC5. [17]
Evidence Score (E-score) 1 +
1 Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism BIRC5 is directly targeted by miR-497. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-552-3p miRNA Info
miRNA Mature AC
MIMAT0003215
Sequence aacaggugacugguuagacaa
miRNA Species Homo sapiens
Regulation Mechanism BIRC5 is a direct target of miR-552-3p. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
References  Top
REF 1 miR-203 inhibits proliferation and self-renewal of leukemia stem cells by targeting survivin and Bmi-1. Sci Rep. 2016 Feb 5;6:19995.
REF 2 MicroRNA-203 leads to G1 phase cell cycle arrest in laryngeal carcinoma cells by directly targeting survivin. FEBS Lett. 2012 Mar 23;586(6):804-9.
REF 3 The expression and function of microRNA-203 in lung cancer. Tumour Biol. 2013 Feb;34(1):349-57.
REF 4 MicroRNA-203 suppresses cell proliferation and migration by targeting BIRC5 and LASP1 in human triple-negative breast cancer cells. J Exp Clin Cancer Res. 2012 Jun 19;31:58.
REF 5 miR-203 inhibits proliferation of HCC cells by targeting survivin. Cell Biochem Funct. 2013 Jan;31(1):82-5.
REF 6 miR-335 directly, while miR-34a indirectly modulate survivin expression and regulate growth, apoptosis, and invasion of gastric cancer cells. Tumour Biol. 2016 Feb;37(2):1771-9.
REF 7 MicroRNA-34a regulates WNT/TCF7 signaling and inhibits bone metastasis in Ras-activated prostate cancer. Oncotarget. 2015 Jan 1;6(1):441-57.
REF 8 miR-34a regulates cisplatin-induce gastric cancer cell death by modulating PI3K/AKT/survivin pathway. Tumour Biol. 2014 Feb;35(2):1287-95.
REF 9 Expression and regulatory function of miRNA-34a in targeting survivin in gastric cancer cells. Tumour Biol. 2013 Apr;34(2):963-71.
REF 10 Induction of growth arrest by miR-542-3p that targets survivin. FEBS Lett. 2010 Sep 24;584(18):4048-52.
REF 11 miR-542-3p exerts tumor suppressive functions in neuroblastoma by downregulating Survivin. Int J Cancer. 2015 Mar 15;136(6):1308-20.
REF 12 Hyaluronic acid-coated PEI-PLGA nanoparticles mediated co-delivery of doxorubicin and miR-542-3p for triple negative breast cancer therapy. Nanomedicine. 2016 Feb;12(2):411-20.
REF 13 Overexpression of miR-214-3p in esophageal squamous cancer cells enhances sensitivity to cisplatin by targeting survivin directly and indirectly through CUG-BP1. Oncogene. 2016 Apr 21;35(16):2087-97.
REF 14 Genetic variation in a miR-335 binding site in BIRC5 alters susceptibility to lung cancer in Chinese Han populations. Biochem Biophys Res Commun. 2013 Jan 11;430(2):529-34.
REF 15 Low expression of miR-150 in pediatric intestinal Burkitt lymphoma. Exp Mol Pathol. 2014 Apr;96(2):261-6.
REF 16 The microRNA expression signature of bladder cancer by deep sequencing: the functional significance of the miR-195/497 cluster. PLoS One. 2014 Feb 10;9(2):e84311.
REF 17 Targeting survivin using a combination of miR 94 and survivin shRNA has synergistic effects on the suppression of prostate cancer growth. Mol Med Rep. 2016 Feb;13(2):1602-10.
REF 18 MicroRNA-708 induces apoptosis and suppresses tumorigenicity in renal cancer cells. Cancer Res. 2011 Oct 1;71(19):6208-19.
REF 19 MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis. Exp Cell Res. 2015 Dec 10;339(2):320-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.