miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-552-3p | ||||
| miRNA Stemloop AC | MI0003557 | ||||
| miRNA Stemloop ID | hsa-mir-552 | ||||
| Sequence | aacaggugacugguuagacaa | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Apoptosis inhibitor survivin (BIRC5) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Phosphatidylinositol 3-kinase regulatory subunit beta | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104. | ||||
| REF 2 | MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis. Exp Cell Res. 2015 Dec 10;339(2):320-32. | ||||
| REF 3 | MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis. Exp Cell Res. 2015 Dec 10;339(2):320-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.