Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00033 Target Info
Target Name Transforming growth factor alpha (TGFA)
Synonyms TGF-alpha (40-89); TGF type 1 (40-89); Protransforming growth factor alpha (40-89); ETGF (40-89); EGF-like TGF (40-89)
Target Type Clinical trial Target
Gene Name TGFA
Biochemical Class Growth factor
UniProt ID
P01135
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-376c-3p miRNA Info
miRNA Mature AC
MIMAT0000720
Sequence aacauagaggaaauuccacgu
miRNA Species Homo sapiens
Regulation Mechanism The luciferase activity of miR-376c transfected cells was significantly reduced and miR-376c-mediated repression of luciferase activity was abolished by the mutant putative binding site. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 Controls Migration and Invasive Potentialby Targeting TGFa in Prostate Cancer Cell Lines. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-490-3p miRNA Info
miRNA Mature AC
MIMAT0002806
Sequence caaccuggaggacuccaugcug
miRNA Species Homo sapiens
Regulation Mechanism miR-490-3p directly targeted TGFa by binding its 3'UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-505-3p miRNA Info
miRNA Mature AC
MIMAT0002876
Sequence cgucaacacuugcugguuuccu
miRNA Species Homo sapiens
Regulation Mechanism miR-505 acts as tumor suppressor in EC by regulating TGFA. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Gankyrin (PSMD10) Target Info
PSD10_HUMAN
Transforming growth factor alpha (TGFA) Target Info
TGFA_HUMAN
References  Top
REF 1 MicroRNA-376c inhibits cell proliferation and invasion in osteosarcoma by targeting to transforming growth factor-alpha. DNA Cell Biol. 2013 Jun;32(6):302-9.
REF 2 IL-1beta-mediated NF-B signaling augments the osteosarcoma cell growth through modulating miR-376c/TGFA axis. Pharmazie. 2017 Jul 3;72(7):419-424.
REF 3 miR-152 controls migration and invasive potential by targeting TGF in prostate cancer cell lines. Prostate. 2013 Jul;73(10):1082-9.
REF 4 The correlation between microRNA490-3p and TGF in endometrial carcinoma tumorigenesis and progression. Oncotarget. 2016 Feb 23;7(8):9236-49.
REF 5 MicroRNA-505 functions as a tumor suppressor in endometrial cancer by targeting TGF-. Mol Cancer. 2016 Feb 2;15:11.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.