miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-505-3p | ||||
miRNA Stemloop AC | MI0003190 | ||||
miRNA Stemloop ID | hsa-mir-505 | ||||
Sequence | cgucaacacuugcugguuuccu | ||||
TTD Target(s) Regulated by This miRNA | Transforming growth factor alpha (TGFA) | Clinical trial Target | Target Info | [1] | |
Gankyrin (PSMD10) | Literature-reported Target | Target Info | [2] | ||
Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase AMFR | Regulated Protein | [3] | ||
Serine/arginine-rich splicing factor 1 | Regulated Protein | [4] | |||
References | |||||
REF 1 | MicroRNA-505 functions as a tumor suppressor in endometrial cancer by targeting TGF-. Mol Cancer. 2016 Feb 2;15:11. | ||||
REF 2 | Association between functional PSMD10 Rs111638916 variant regulated by MiR-505 and gastric cancer risk in a Chinese population. Cell Physiol Biochem. 2015;37(3):1010-7. | ||||
REF 3 | MicroRNAs Provide Feedback Regulation of Epithelial-Mesenchymal Transition Induced by Growth Factors.J Cell Physiol. 2016 Jan;231(1):120-9. | ||||
REF 4 | MicroRNA (miRNA)-mediated interaction between leukemia/lymphoma-related factor (LRF) and alternative splicing factor/splicing factor 2 (ASF/SF2) affects mouse embryonic fibroblast senescence and apoptosis.J Biol Chem. 2010 Dec 10;285(50):39551-63. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.