miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-376c-3p | ||||
| miRNA Stemloop AC | MI0000776 | ||||
| miRNA Stemloop ID | hsa-mir-376c | ||||
| Sequence | aacauagaggaaauuccacgu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [3] | ||
| Transforming growth factor alpha (TGFA) | Clinical trial Target | Target Info | [4] | ||
| Liver receptor homolog-1 (NR5A2) | Literature-reported Target | Target Info | [5] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [6] | ||
| Runt-related transcription factor 2 (RUNX2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Activin receptor type-1C | Regulated Protein | [8] | ||
| UDP-glucuronosyltransferase 2B15 | Regulated Protein | [9] | |||
| UDP-glucuronosyltransferase 2B17 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | Silencing of a large microRNA cluster on human chromosome 14q32 in melanoma: biological effects of mir-376a and mir-376c on insulin growth factor 1 receptor. Mol Cancer. 2012 Jul 2;11:44. | ||||
| REF 2 | hsa-miR-376c-3p Regulates Gastric Tumor Growth Both In Vitro and In Vivo. Biomed Res Int. 2016;2016:9604257. | ||||
| REF 3 | MicroRNA-376c impairs transforming growth factor- and nodal signaling to promote trophoblast cell proliferation and invasion. Hypertension. 2013 Apr;61(4):864-72. | ||||
| REF 4 | MicroRNA-376c inhibits cell proliferation and invasion in osteosarcoma by targeting to transforming growth factor-alpha. DNA Cell Biol. 2013 Jun;32(6):302-9. | ||||
| REF 5 | MicroRNA-376c suppresses non-small-cell lung cancer cell growth and invasion by targeting LRH-1-mediated Wnt signaling pathway. Biochem Biophys Res Commun. 2016 May 13;473(4):980-986. | ||||
| REF 6 | miR-376c inhibits cervical cancer cell proliferation and invasion by targeting BMI1. Int J Exp Pathol. 2016 Jun;97(3):257-65. | ||||
| REF 7 | Dysregulation of RUNX2/Activin-A Axis upon miR-376c Downregulation Promotes Lymph Node Metastasis in Head and Neck Squamous Cell Carcinoma. Cancer Res. 2016 Dec 15;76(24):7140-7150. | ||||
| REF 8 | MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68. | ||||
| REF 9 | Epigenetic regulation of steroid inactivating UDP-glucuronosyltransferases by microRNAs in prostate cancer.J Steroid Biochem Mol Biol. 2016 Jan;155(Pt A):85-93. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.