Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T92057 Target Info
Target Name Erbb4 tyrosine kinase receptor (Erbb-4)
Synonyms Tyrosine kinase-type cell surface receptor HER4; Receptor tyrosine-protein kinase erbB-4; Proto-oncogene-like protein c-ErbB-4; P180erbB4; HER4
Target Type Successful Target
Gene Name ERBB4
Biochemical Class Kinase
UniProt ID
Q15303
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a target sites were confirmed in human ERBB4. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Western Blot [1]
2 Luciferase Reporter Assay; Northern Blot [2]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Regulation Mechanism miR-146b targets ERBB4 to decrease the survival of cisplatin-injured NRK52E cells. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Western Blot; qPCR [4]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism ERBB4 is a direct target gene of miR-193a-3p. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot; Luciferase Reporter Assay; qRT-PCR [6]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Microarray [7]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism ERBB4 is a target of miR-302b. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-302d-3p miRNA Info
miRNA Mature AC
MIMAT0000718
Sequence uaagugcuuccauguuugagugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Microarray [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Erbb4 tyrosine kinase receptor (Erbb-4) Target Info
ERBB4_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Microarray [7]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
References  Top
REF 1 Regulation of ErbB receptor signalling in cancer cells by microRNA. Curr Opin Pharmacol. 2010 Dec;10(6):655-61.
REF 2 MicroRNA-146a is a therapeutic target and biomarker for peripartum cardiomyopathy. J Clin Invest. 2013 May;123(5):2143-54.
REF 3 MicroRNA-146b, a Sensitive Indicator of Mesenchymal Stem Cell Repair of Acute Renal Injury. Stem Cells Transl Med. 2016 Oct;5(10):1406-1415.
REF 4 miR-146a Attenuates Sepsis-Induced Myocardial Dysfunction by Suppressing IRAK1 and TRAF6 via Targeting ErbB4 Expression. Oxid Med Cell Longev. 2018 Aug 27;2018:7163057.
REF 5 MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23.
REF 6 Gain-of-function microRNA screens identify miR-193a regulating proliferation and apoptosis in epithelial ovarian cancer cells. Int J Oncol. 2013 Jun;42(6):1875-82.
REF 7 Identification of microRNAs regulated by activin A in human embryonic stem cells. J Cell Biochem. 2010 Jan 1;109(1):93-102.
REF 8 miR-302b is a potential molecular marker of esophageal squamous cell carcinoma and functions as a tumor suppressor by targeting ErbB4. J Exp Clin Cancer Res. 2014 Jan 19;33:10.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.