Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T91331 Target Info
Target Name Fibroblast growth factor receptor 3 (FGFR3)
Synonyms JTK4; FGFR-3; CD333
Target Type Successful Target
Gene Name FGFR3
Biochemical Class Kinase
UniProt ID
P22607
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-100-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target FGFR3. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-99a-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target FGFR3. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot; Luciferase Immunocytochemistry [2]
4 Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152-3p binds specifically to the 3'UTR region of FGFR3, blocking its transcription. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-425-5p miRNA Info
miRNA Mature AC
MIMAT0003393
Sequence aaugacacgaucacucccguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-425-5p binds specifically to the 3'UTR region of FGFR3, blocking its transcription. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 Overexpression of miR-100 inhibits cell proliferation, migration, and chemosensitivity in human glioblastoma through FGFR3. Onco Targets Ther. 2015 Nov 17;8:3391-400.
REF 2 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82.
REF 3 Hypoxia regulates FGFR3 expression via HIF-1 and miR-100 and contributes to cell survival in non-muscle invasive bladder cancer. Br J Cancer. 2013 Jul 9;109(1):50-9.
REF 4 Distinct microRNA alterations characterize high- and low-grade bladder cancer. Cancer Res. 2009 Nov 1;69(21):8472-81.
REF 5 MicroRNA 100: a context dependent miRNA in prostate cancer. Clinics (Sao Paulo). 2013 Jun;68(6):797-802.
REF 6 miR-99a promotes proliferation targeting FGFR3 in human epithelial ovarian cancer cells. Biomed Pharmacother. 2014 Mar;68(2):163-9.
REF 7 MicroRNA-mediated downregulation of mTOR/FGFR3 controls tumor growth induced by Src-related oncogenic pathways. Oncogene. 2011 Aug 11;30(32):3489-501.
REF 8 Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.