Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88505 Target Info
Target Name Nuclear factor erythroid 2-related factor 2 (Nrf2)
Synonyms Nuclear factor, erythroid derived 2, like 2; NRF2; NFE2-related factor 2; NF-E2-related factor 2; HEBP1
Target Type Successful Target
Gene Name NFE2L2
Biochemical Class Basic leucine zipper bZIP
UniProt ID
Q16236
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR144 directly targets Nrf2 3' UTR. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miR27a directly targets Nrf2 3'UTR. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot; Luciferase Reporter Assay; ChIP [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism miR142-5p directly targets Nrf2 3' UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-132-5p miRNA Info
miRNA Mature AC
MIMAT0004594
Sequence accguggcuuucgauuguuacu
miRNA Species Homo sapiens
Regulation Mechanism NFE2L2 was a targets of miR-132. [4]
Evidence Score (E-score) 1 +
1 Immunoblot [4]
Representative Target(s) Regulated by This miRNA Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
Nuclear factor erythroid 2-related factor 2 (Nrf2) Target Info
NF2L2_HUMAN
References  Top
REF 1 Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111.
REF 2 miR-144 reverses chemoresistance of hepatocellular carcinoma cell lines by targeting Nrf2-dependent antioxidant pathway. Am J Transl Res. 2016 Jul 15;8(7):2992-3002.
REF 3 Activation of a novel c-Myc-miR27-prohibitin 1 circuitry in cholestatic liver injury inhibits glutathione synthesis in mice. Antioxid Redox Signal. 2015 Jan 20;22(3):259-74.
REF 4 Porphyromonas gingivalis-induced miR-132 regulates TNF expression in THP-1 derived macrophages. Springerplus. 2016 Jun 17;5(1):761.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.