Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82078 Target Info
Target Name Toll-like receptor 2 (TLR2)
Synonyms Toll/interleukin-1 receptor-like protein 4; TIL4; CD282
Target Type Clinical trial Target
Gene Name TLR2
Biochemical Class Toll-like receptor
UniProt ID
O60603
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-143 resulted inthe decreased level of mRNA and protein expressions of TLR2. [2]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Northern Blot; RT-PCR [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Ectopic miR-146a in monocytes and intDCs interfered with TLR2 downstream signaling and cytokine production, without affecting phenotypic DC maturation. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 RT-PCR [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism miR-19a is important in the regulation of IL-6 and MMP3 release by controlling TLR2 expression. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-154-5p miRNA Info
miRNA Mature AC
MIMAT0000452
Sequence uagguuauccguguugccuucg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
Toll-like receptor 2 (TLR2) Target Info
TLR2_HUMAN
miRNA Mature ID hsa-miR-23a-5p miRNA Info
miRNA Mature AC
MIMAT0004496
Sequence gggguuccuggggaugggauuu
miRNA Species Homo sapiens
Regulation Mechanism TLR2 displayed a potential seed match for miR-23a-5p in its 3'UTR. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot; RT-PCR [10]
Representative Target(s) Regulated by This miRNA Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
Lysosome-associated membrane glycoprotein 1 (CD107a) Target Info
LAMP1_HUMAN
miRNA Mature ID hsa-miR-105-5p miRNA Info
miRNA Mature AC
MIMAT0000102
Sequence ucaaaugcucagacuccuguggu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-105-5p resulted in the changed protein level of target TLR2. [11]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Toll-like receptor 2 (TLR2) Target Info
TLR2_HUMAN
References  Top
REF 1 The regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal carcinoma cells. Mol Cancer. 2013 Jul 17;12:77.
REF 2 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 3 miR-146a is differentially expressed by myeloid dendritic cell subsets and desensitizes cells to TLR2-dependent activation. J Immunol. 2010 May 1;184(9):4955-65.
REF 4 MiR-146a negatively regulates TLR2-induced inflammatory responses in keratinocytes. J Invest Dermatol. 2014 Jul;134(7):1931-1940.
REF 5 MiR-19 suppresses fibroblast-like synoviocytes cytokine release by targeting toll like receptor 2 in rheumatoid arthritis. Am J Transl Res. 2016 Dec 15;8(12):5512-5518.
REF 6 TLR2 expression is regulated by microRNA miR-19 in rheumatoid fibroblast-like synoviocytes. J Immunol. 2012 Jan 1;188(1):454-61.
REF 7 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 8 miR-154 suppresses colorectal cancer cell growth and motility by targeting TLR2. Mol Cell Biochem. 2014 Feb;387(1-2):271-7.
REF 9 MiR-23a-5p modulates mycobacterial survival and autophagy during mycobacterium tuberculosis infection through TLR2/MyD88/NF-B pathway by targeting TLR2. Exp Cell Res. 2017 May 15;354(2):71-77.
REF 10 Identification of microRNAs that regulate TLR2-mediated trophoblast apoptosis and inhibition of IL-6 mRNA. PLoS One. 2013 Oct 15;8(10):e77249.
REF 11 Modulation of TLR2 protein expression by miR-105 in human oral keratinocytes. J Biol Chem. 2009 Aug 21;284(34):23107-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.