Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T78429 Target Info
Target Name Inhibitor of nuclear factor kappa-B kinase beta (IKKB)
Synonyms Nuclear factor NF-kappa-B inhibitor kinase beta; NFKBIKB; Inhibitor of nuclear factor kappa-B kinase subunit beta; IkBKB; IKKB; IKK2; IKK-beta; IKK-B; I-kappa-B-kinase beta; I-kappa-B kinase 2
Target Type Clinical trial Target
Gene Name IKBKB
Biochemical Class Kinase
UniProt ID
O14920
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a-3p was found to be a novel repressor of IKBKB based on data from qPCR, luciferase, and Western blot experiments. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b suppressed the luciferase intensity of the IKBKB 3'UTR. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200c Targets the Expression of IKBKB and Alters Cellular Proliferation. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497 may function as a tumor suppressor genes by regulating IKK-B in PCa, and may provide a strategy for blocking PCa metastasis. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Western Blot [8]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism miR-451 upregulation led to downregulation of cyclin D1 and c-Myc through inhibition of NF-KB pathway initiated by direct targeting of the IKBKB 3'untranslated region. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism miR-503 inhibits the malignant phenotype of NSCLC by targeting IKK-B. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-196a-5p miRNA Info
miRNA Mature AC
MIMAT0000226
Sequence uagguaguuucauguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-196a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target IKBKB. [11]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Calgranulin B (S100A9) Target Info
S10A9_HUMAN
Homeobox protein Hox-A7 (HOXA7) Target Info
HXA7_HUMAN
References  Top
REF 1 The stretch responsive microRNA miR-148a-3p is a novel repressor of IKBKB, NF-B signaling, and inflammatory gene expression in human aortic valve cells. FASEB J. 2015 May;29(5):1859-68.
REF 2 The regulatory function of miR-200c on inflammatory and cell-cycle associated genes in SK-LMS-1, a leiomyosarcoma cell line. Reprod Sci. 2015 May;22(5):563-71.
REF 3 A negative feedback loop between miR-200b and the nuclear factor-B pathway via IKBKB/IKK- in breast cancer cells. FEBS J. 2016 Jun;283(12):2259-71.
REF 4 MiR-200b attenuates IL-6 production through IKKbeta and ZEB1 in human gingival fibroblasts. Inflamm Res. 2018 Dec;67(11-12):965-973.
REF 5 miR-200c regulates IL8 expression by targeting IKBKB: a potential mediator of inflammation in leiomyoma pathogenesis. PLoS One. 2014 Apr 22;9(4):e95370.
REF 6 Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKK, KLF9, and FBLN5. Reprod Sci. 2012 Aug;19(8):786-96.
REF 7 Tumor-suppressive microRNA-497 targets IKK to regulate NF-B signaling pathway in human prostate cancer cells. Am J Cancer Res. 2015 Apr 15;5(5):1795-804.
REF 8 MicroRNA analysis suggests an additional level of feedback regulation in the NF-B signaling cascade. Oncotarget. 2015 Jul 10;6(19):17097-106.
REF 9 miR-451 inhibits cell proliferation in human hepatocellular carcinoma through direct suppression of IKK-. Carcinogenesis. 2013 Nov;34(11):2443-51.
REF 10 MiR-503 targets PI3K p85 and IKK- and suppresses progression of non-small cell lung cancer. Int J Cancer. 2014 Oct 1;135(7):1531-42.
REF 11 Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cells. Oncogene. 2008 Aug 7;27(34):4712-23.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.