Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T77594 Target Info
Target Name Endoplasmic reticulum chaperone BiP (HSPA5)
Synonyms Immunoglobulin heavy chainbinding protein; Immunoglobulin heavy chain-binding protein; Heat shock protein family A member 5; Heat shock protein 70 family protein 5; Heat shock 70 kDa protein 5; HSP70 family protein 5; GRP78; GRP-78; Endoplasmic reticulum lumenal Ca(2+)binding protein grp78; Binding-immunoglobulin protein; BiP; 78 kDa glucose-regulated protein
Target Type Clinical trial Target
Gene Name HSPA5
Biochemical Class Acid anhydride hydrolase
UniProt ID
P11021
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-384 miRNA Info
miRNA Mature AC
MIMAT0001075
Sequence auuccuagaaauuguucaua
miRNA Species Homo sapiens
Regulation Mechanism The direct link between miR-384-5p and the 3'UTR of HSPA5 was confirmed by a dual-luciferase activity and miR-384-5p negatively regulated the expression of HSPA5. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of the miR-30 family miRNAs contributes to the endoplasmic reticulum stress and the associated upregulation of GRP78 in the cardiovascular system, and GRP78 was confirmed to be a target gene for miR-30. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of HSPA5 expression level following hsa-miR-495 overexpression in A549 and QU-DB cell lines and Upregulation of HSPA5 expression levels following introducing the sponges of hsa-miR-495 to A549 and QU-DB cell lines. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
References  Top
REF 1 miR-199a-5p and miR-495 target GRP78 within UPR pathway of lung cancer. Gene. 2017 Jul 15;620:15-22.
REF 2 Downregulation of miR-384-5p attenuates rotenone-induced neurotoxicity in dopaminergic SH-SY5Y cells through inhibiting endoplasmic reticulum stress. Am J Physiol Cell Physiol. 2016 May 1;310(9):C755-63.
REF 3 Downregulation of the miR-30 family microRNAs contributes to endoplasmic reticulum stress in cardiac muscle and vascular smooth muscle cells. Int J Cardiol. 2014 Apr 15;173(1):65-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.