The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-106a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
MAPK9 3'UTR is a direct target of miR-106a. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Report Assay; RT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-143-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagaugaagcacuguagcuc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Introduction of miR-143 mimic decreased the protein level of LIMK1. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
2 |
Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Connective tissue growth factor (CTGF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
MAPK9 3'UTR is a direct target of miR-17. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcucauagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
MAPK9 3'UTR is a direct target of miR-20b. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|