Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T69085 Target Info
Target Name Transcription factor AP-1 (JUN)
Synonyms V-jun avian sarcoma virus 17 oncogene homolog; Proto-oncogene c-jun; P39; C-jun proto-oncogene; Activator protein-1; Activator protein 1; AP1; AP-1 transcription factor
Target Type Discontinued Target
Gene Name JUN
Biochemical Class Basic leucine zipper bZIP
UniProt ID
P05412
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-139, down-regulated in human gastric cancer might play tumour suppressive roles through regulating the expression of Jun, an important component of the activator protein-1 (AP-1) transcription factor. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 PAR-CLIP [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; Immunohistochemistry; In Situ Hybridization; Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216b directly targets c-Jun reducing AP-1-dependent transcription and sensitizing cells to ER stress-dependent apoptosis. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-1470 miRNA Info
miRNA Mature AC
MIMAT0007348
Sequence gcccuccgcccgugcaccccg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-1470 resulted in a significant decrease in the luciferase reporter activity, when compared to cells treated with the scrambled ncRNA. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Transcription factor AP-1 (JUN) Target Info
JUN_HUMAN
References  Top
REF 1 Involvement of aberrant miR-139/Jun feedback loop in human gastric cancer. Biochim Biophys Acta. 2015 Feb;1853(2):481-8.
REF 2 Recovery of miR-139-5p in Ovarian Cancer Reverses Cisplatin Resistance by Targeting C-Jun. Cell Physiol Biochem. 2018;51(1):129-141.
REF 3 miR-200b inhibits TNF--induced IL-8 secretion and tight junction disruption of intestinal epithelial cells in vitro. Am J Physiol Gastrointest Liver Physiol. 2017 Feb 1;312(2):G123-G132.
REF 4 Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
REF 5 MiR-155 negatively regulates c-Jun expression at the post-transcriptional level in human dermal fibroblasts in vitro: implications in UVA irradiation-induced photoaging. Cell Physiol Biochem. 2012;29(3-4):331-40.
REF 6 MicroRNA-203 functions as a tumor suppressor in basal cell carcinoma. Oncogenesis. 2012 Mar 12;1:e3.
REF 7 miR-216b regulation of c-Jun mediates GADD153/CHOP-dependent apoptosis. Nat Commun. 2016 May 13;7:11422.
REF 8 miR-1470 mediates lapatinib induced p27 upregulation by targeting c-jun. J Cell Physiol. 2015 Jul;230(7):1630-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.