Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65005 Target Info
Target Name Hyperpolarization cyclic nucleotide-gated channel 2 (HCN2)
Synonyms Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2; Brain cyclic nucleotide-gated channel 2; BCNG2; BCNG-2
Target Type Literature-reported Target
Gene Name HCN2
Biochemical Class Voltage-gated ion channel
UniProt ID
Q9UL51
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-1-3p by mature miRNA transfection resulted in the decreased protein level of target HCN2; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target HCN2. [2]
Evidence Score (E-score) 2 +
1 Western Blot; PCR [1]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-133a-3p miRNA Info
miRNA Mature AC
MIMAT0000427
Sequence uuugguccccuucaaccagcug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-133a-3p by mature miRNA transfection resulted in the decreased protein level of target HCN2; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target HCN2. [2]
Evidence Score (E-score) 2 +
1 Western Blot; PCR [1]
2 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Caspase-9 (CASP9) Target Info
CASP9_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Reporter Assay [2]
2 Western Blot; PCR [1]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 Altered expression of hyperpolarization-activated cyclic nucleotide-gated channels and microRNA-1 and -133 in patients with age-associated atrial f... Mol Med Rep. 2015 Sep;12(3):3243-3248.
REF 2 Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart. J Biol Chem. 2008 Jul 18;283(29):20045-52.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.