Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63083 Target Info
Target Name DNA repair protein RAD51 homolog 1 (RAD51)
Synonyms hRAD51; RECA; RAD51A; RAD51 homolog A; HsRAD51
Target Type Clinical trial Target
Gene Name RAD51
UniProt ID
Q06609
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 directly targets RAD51. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot? [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of microRNA 155 (miR-155) in human breast cancer cells reduces the levels of RAD51 and miR-155 directly targets the 3'untranslated region of RAD51. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-193b-3p expression was caused by histone deacetylation on the miR-193b-3p promoter in the HepG2 cells irradiated with 0.01Gy. [6]
Evidence Score (E-score) 2 +
1 ChIP; Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Microarray [6]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism RAD51 3'UTR is a putative consensus for miR-221. [7]
Evidence Score (E-score) 1 +
1 Western Blot [7]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Regulation Mechanism miR-96 directly targeted the coding region of RAD51. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
References  Top
REF 1 Systematic screen identifies miRNAs that target RAD51 and RAD51D to enhance chemosensitivity. Mol Cancer Res. 2013 Dec;11(12):1564-73.
REF 2 Synthetically Lethal BMN 673 (Talazoparib) Loaded Solid Lipid Nanoparticles for BRCA1 Mutant Triple Negative Breast Cancer. Pharm Res. 2018 Sep 25;35(11):218.
REF 3 Protective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiation. Proc Natl Acad Sci U S A. 2014 Mar 25;111(12):4536-41.
REF 4 Neutrophil-induced genomic instability impedes resolution of inflammation and wound healing. J Clin Invest. 2019 Feb 1;129(2):712-726.
REF 5 Low-dose irradiation promotes Rad51 expression by down-regulating miR-193b-3p in hepatocytes. Sci Rep. 2016 May 26;6:25723.
REF 6 MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9.
REF 7 Slug/-catenin-dependent proinflammatory phenotype in hypoxic breast cancer stem cells. Am J Pathol. 2013 Nov;183(5):1688-1697.
REF 8 In Vivo Delivery of miR-34a Sensitizes Lung Tumors to Radiation Through RAD51 Regulation. Mol Ther Nucleic Acids. 2015 Dec 15;4:e270.
REF 9 MiR-96 downregulates REV1 and RAD51 to promote cellular sensitivity to cisplatin and PARP inhibition. Cancer Res. 2012 Aug 15;72(16):4037-46.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.