Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T58548 |
Target Info
|
| Target Name |
Stanniocalcin-2 (STC2) |
| Synonyms |
Stanniocalcin-related protein; STCRP; STC-related protein; STC-2 |
| Target Type |
Literature-reported Target |
| Gene Name |
STC2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggaauguaaggaagugugugg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The anti-metastasis effect of miR-206 is mediated by targeting metastasis regulatory gene STC2 which was drastically down-regulated by stable expression of exogenous miR-206 in SGC7901 cells. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR; ELISA; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-485-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agaggcuggccgugaugaauuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Stanniocalcin 2 was a direct target of miR-485-5p. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
|
Frizzled-7 receptor (FZD7)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48.
|
| REF 2 |
MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
|
| REF 3 |
MicroRNA-485-5p suppresses cell proliferation and invasion in hepatocellular carcinoma by targeting stanniocalcin 2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12292-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
