The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuaugccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA |
[1] |
2 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucccuuugucauccuucgccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-211 directly target IL11 by binding to its 3 UTR. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
2 |
Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-379-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugguagacuauggaacguagg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-379 directly target IL11 by binding to its 3 UTR. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Focal adhesion kinase 1 (FAK)
|
Target Info
|
|
Interleukin-11 (IL11)
|
Target Info
|
|