miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-379-5p | ||||
miRNA Stemloop AC | MI0000787 | ||||
miRNA Stemloop ID | hsa-mir-379 | ||||
Sequence | ugguagacuauggaacguagg | ||||
TTD Target(s) Regulated by This miRNA | Focal adhesion kinase 1 (FAK) | Clinical trial Target | Target Info | [1] | |
Interleukin-11 (IL11) | Clinical trial Target | Target Info | [2] | ||
References | |||||
REF 1 | MicroRNA-379-5p inhibits tumor invasion and metastasis by targeting FAK/AKT signaling in hepatocellular carcinoma. Cancer Lett. 2016 May 28;375(1):73-83. | ||||
REF 2 | Identification of microRNAs inhibiting TGF--induced IL-11 production in bone metastatic breast cancer cells. PLoS One. 2012;7(5):e37361. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.